Incidental Mutation 'R1463:Kif3b'
ID159205
Institutional Source Beutler Lab
Gene Symbol Kif3b
Ensembl Gene ENSMUSG00000027475
Gene Namekinesin family member 3B
Synonyms
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1463 (G1)
Quality Score189
Status Validated
Chromosome2
Chromosomal Location153291413-153333390 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 153330153 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 748 (*748Q)
Ref Sequence ENSEMBL: ENSMUSP00000028977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028977]
Predicted Effect probably null
Transcript: ENSMUST00000028977
AA Change: *748Q
SMART Domains Protein: ENSMUSP00000028977
Gene: ENSMUSG00000027475
AA Change: *748Q

DomainStartEndE-ValueType
KISc 7 348 6.36e-186 SMART
low complexity region 370 412 N/A INTRINSIC
low complexity region 437 458 N/A INTRINSIC
Blast:KISc 459 535 3e-10 BLAST
low complexity region 537 548 N/A INTRINSIC
Blast:KISc 549 626 4e-27 BLAST
low complexity region 685 697 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Meta Mutation Damage Score 0.466 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a heterodimer with kinesin family member 3A to aid in chromosome movement during mitosis and meiosis. The encoded protein is a plus end-directed microtubule motor and can interact with the SMC3 subunit of the cohesin complex. In addition, the encoded protein may be involved in the intracellular movement of membranous organelles. This protein and kinesin family member 3A form the kinesin II subfamily of the kinesin superfamily. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygoous for a targeted null mutation are growth retarded and display neural tube defects, incomplete embryo turning, randomized left-right assymetry, pericardial edema, and die during the midgestational period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Kif3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kif3b APN 2 153317131 missense probably damaging 0.99
IGL00927:Kif3b APN 2 153316461 missense possibly damaging 0.89
IGL02121:Kif3b APN 2 153317274 missense probably damaging 0.99
IGL02302:Kif3b APN 2 153316948 missense probably damaging 1.00
IGL02306:Kif3b APN 2 153320652 missense probably damaging 1.00
IGL02348:Kif3b APN 2 153316893 missense probably damaging 0.98
IGL03111:Kif3b APN 2 153330068 missense probably benign 0.00
R1474:Kif3b UTSW 2 153320315 missense probably damaging 1.00
R1485:Kif3b UTSW 2 153322931 splice site probably null
R1538:Kif3b UTSW 2 153317462 small deletion probably benign
R1834:Kif3b UTSW 2 153317485 missense probably benign 0.22
R2371:Kif3b UTSW 2 153322823 missense possibly damaging 0.66
R4051:Kif3b UTSW 2 153323557 missense probably damaging 0.99
R4208:Kif3b UTSW 2 153323557 missense probably damaging 0.99
R4504:Kif3b UTSW 2 153323644 critical splice donor site probably null
R4619:Kif3b UTSW 2 153316674 nonsense probably null
R4806:Kif3b UTSW 2 153320368 missense probably damaging 1.00
R4911:Kif3b UTSW 2 153317292 nonsense probably null
X0026:Kif3b UTSW 2 153316321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACGCCATTGAGGAAAGGCTAC -3'
(R):5'- GACAGAGGCAGGCACCTATTCAAG -3'

Sequencing Primer
(F):5'- AAGGCTACCTTGGAACGTGC -3'
(R):5'- agagaagaggagaggaaggg -3'
Posted On2014-03-14