Incidental Mutation 'R1463:Cacna1c'
ID159219
Institutional Source Beutler Lab
Gene Symbol Cacna1c
Ensembl Gene ENSMUSG00000051331
Gene Namecalcium channel, voltage-dependent, L type, alpha 1C subunit
SynonymsCav1.2, D930026N18Rik, Cchl1a1, (alpha)1 subunit, L-type Cav1.2
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.727) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118587240-119196418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 118593994 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 2106 (D2106E)
Ref Sequence ENSEMBL: ENSMUSP00000139981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075591] [ENSMUST00000078320] [ENSMUST00000112790] [ENSMUST00000112793] [ENSMUST00000112825] [ENSMUST00000185345] [ENSMUST00000186889] [ENSMUST00000187317] [ENSMUST00000187386] [ENSMUST00000187474] [ENSMUST00000187940] [ENSMUST00000188078] [ENSMUST00000188106] [ENSMUST00000188522] [ENSMUST00000188865] [ENSMUST00000189389] [ENSMUST00000189520] [ENSMUST00000190285] [ENSMUST00000219018] [ENSMUST00000219223] [ENSMUST00000219833] [ENSMUST00000220022]
Predicted Effect probably benign
Transcript: ENSMUST00000075591
AA Change: D2106E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000075021
Gene: ENSMUSG00000051331
AA Change: D2106E

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 3.5e-60 PFAM
PDB:4DEY|B 246 369 2e-57 PDB
low complexity region 370 384 N/A INTRINSIC
transmembrane domain 390 409 N/A INTRINSIC
Pfam:Ion_trans 424 618 1.3e-46 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
Pfam:Ion_trans 801 1031 2.6e-51 PFAM
Pfam:PKD_channel 1095 1348 2.7e-10 PFAM
Pfam:Ion_trans 1119 1341 3.9e-70 PFAM
Blast:EFh 1362 1390 4e-9 BLAST
Ca_chan_IQ 1476 1510 3.28e-15 SMART
low complexity region 1630 1640 N/A INTRINSIC
low complexity region 1810 1824 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078320
AA Change: D2106E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077433
Gene: ENSMUSG00000051331
AA Change: D2106E

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 1.4e-59 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 5.2e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 2.5e-51 PFAM
Pfam:PKD_channel 1070 1323 1.1e-9 PFAM
Pfam:Ion_trans 1094 1316 1.5e-69 PFAM
Blast:EFh 1337 1365 4e-9 BLAST
Ca_chan_IQ 1451 1485 3.28e-15 SMART
low complexity region 1605 1615 N/A INTRINSIC
low complexity region 1785 1799 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112790
AA Change: D2106E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108410
Gene: ENSMUSG00000051331
AA Change: D2106E

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 5.7e-60 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 2.1e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 1e-51 PFAM
Pfam:Ion_trans 1094 1305 1.1e-66 PFAM
Pfam:PKD_channel 1140 1312 1.3e-8 PFAM
Blast:EFh 1326 1354 4e-9 BLAST
Ca_chan_IQ 1440 1474 3.28e-15 SMART
low complexity region 1594 1604 N/A INTRINSIC
low complexity region 1774 1788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112793
AA Change: D2189E

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108413
Gene: ENSMUSG00000051331
AA Change: D2189E

DomainStartEndE-ValueType
Pfam:Ion_trans 1 257 1.8e-64 PFAM
Pfam:PKD_channel 379 624 5.8e-8 PFAM
Pfam:Ion_trans 389 630 5e-56 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
Pfam:Ion_trans 765 1043 8.7e-64 PFAM
Pfam:Ion_trans 1084 1411 6.4e-69 PFAM
Pfam:PKD_channel 1234 1406 9.2e-9 PFAM
Pfam:GPHH 1413 1482 7.7e-40 PFAM
Ca_chan_IQ 1534 1568 3.28e-15 SMART
Pfam:CAC1F_C 1577 2060 3.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112825
AA Change: D1836E

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108444
Gene: ENSMUSG00000051331
AA Change: D1836E

DomainStartEndE-ValueType
Pfam:Ion_trans 1 140 1.8e-31 PFAM
PDB:4DEY|B 141 264 1e-54 PDB
low complexity region 265 279 N/A INTRINSIC
Pfam:Ion_trans 319 513 2e-46 PFAM
low complexity region 528 538 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 606 613 N/A INTRINSIC
Pfam:Ion_trans 659 906 1e-43 PFAM
Pfam:Ion_trans 994 1205 7.1e-70 PFAM
Pfam:PKD_channel 1041 1212 1.6e-8 PFAM
Blast:EFh 1226 1254 4e-9 BLAST
Ca_chan_IQ 1340 1374 3.28e-15 SMART
low complexity region 1494 1504 N/A INTRINSIC
low complexity region 1674 1688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185345
AA Change: D2126E

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140833
Gene: ENSMUSG00000051331
AA Change: D2126E

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 3e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.2e-50 PFAM
Pfam:PKD_channel 1250 1502 6.9e-9 PFAM
Pfam:Ion_trans 1273 1495 6.4e-65 PFAM
Blast:EFh 1516 1544 5e-9 BLAST
Ca_chan_IQ 1630 1664 2.5e-19 SMART
low complexity region 1784 1794 N/A INTRINSIC
low complexity region 1964 1978 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186889
AA Change: D2136E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140056
Gene: ENSMUSG00000051331
AA Change: D2136E

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 1.5e-59 PFAM
PDB:4DEY|B 435 533 5e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 5.6e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 2.7e-51 PFAM
Pfam:PKD_channel 1261 1512 1.3e-9 PFAM
Pfam:Ion_trans 1283 1505 1.7e-69 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187317
AA Change: D2154E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140693
Gene: ENSMUSG00000051331
AA Change: D2154E

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.8e-60 PFAM
PDB:4DEY|B 405 503 2e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.3e-50 PFAM
Pfam:PKD_channel 1249 1530 8.3e-8 PFAM
Pfam:Ion_trans 1273 1326 5e-16 PFAM
Pfam:Ion_trans 1323 1523 2.5e-56 PFAM
Blast:EFh 1544 1572 5e-9 BLAST
Ca_chan_IQ 1658 1692 2.5e-19 SMART
low complexity region 1812 1822 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187386
AA Change: D2102E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140341
Gene: ENSMUSG00000051331
AA Change: D2102E

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Pfam:Ion_trans 132 375 8.5e-60 PFAM
PDB:4DEY|B 376 499 1e-57 PDB
low complexity region 500 514 N/A INTRINSIC
transmembrane domain 520 539 N/A INTRINSIC
Pfam:Ion_trans 554 748 1.4e-44 PFAM
low complexity region 763 773 N/A INTRINSIC
low complexity region 793 805 N/A INTRINSIC
low complexity region 841 848 N/A INTRINSIC
transmembrane domain 892 914 N/A INTRINSIC
Pfam:Ion_trans 931 1161 2.9e-49 PFAM
Pfam:PKD_channel 1226 1478 6.8e-9 PFAM
Pfam:Ion_trans 1249 1471 6.3e-65 PFAM
Blast:EFh 1492 1520 4e-9 BLAST
Ca_chan_IQ 1606 1640 2.5e-19 SMART
low complexity region 1760 1770 N/A INTRINSIC
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187474
AA Change: D2136E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140961
Gene: ENSMUSG00000051331
AA Change: D2136E

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1261 1512 7.3e-10 PFAM
Pfam:Ion_trans 1283 1505 8.3e-70 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187940
AA Change: D2136E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141033
Gene: ENSMUSG00000051331
AA Change: D2136E

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1260 1512 5.8e-11 PFAM
Pfam:Ion_trans 1283 1505 1.2e-66 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188078
AA Change: D2106E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140415
Gene: ENSMUSG00000051331
AA Change: D2106E

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 9e-8 PFAM
Pfam:Ion_trans 1253 1475 4.3e-68 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188106
AA Change: D2120E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000140886
Gene: ENSMUSG00000051331
AA Change: D2120E

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-62 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-46 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-51 PFAM
Pfam:Ion_trans 1278 1489 5.2e-70 PFAM
Pfam:PKD_channel 1325 1496 4.8e-9 PFAM
Blast:EFh 1510 1538 5e-9 BLAST
Ca_chan_IQ 1624 1658 3.28e-15 SMART
low complexity region 1778 1788 N/A INTRINSIC
low complexity region 1958 1972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188181
Predicted Effect probably benign
Transcript: ENSMUST00000188522
AA Change: D2131E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140920
Gene: ENSMUSG00000051331
AA Change: D2131E

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
transmembrane domain 549 568 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-44 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-49 PFAM
Pfam:PKD_channel 1255 1507 7e-9 PFAM
Pfam:Ion_trans 1278 1500 6.4e-65 PFAM
Blast:EFh 1521 1549 5e-9 BLAST
Ca_chan_IQ 1635 1669 2.5e-19 SMART
low complexity region 1789 1799 N/A INTRINSIC
low complexity region 1969 1983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188865
AA Change: D2106E

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139981
Gene: ENSMUSG00000051331
AA Change: D2106E

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 6.8e-9 PFAM
Pfam:Ion_trans 1253 1475 6.3e-65 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189389
AA Change: D2134E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139855
Gene: ENSMUSG00000051331
AA Change: D2134E

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 3e-49 PFAM
Pfam:PKD_channel 1229 1510 8.2e-8 PFAM
Pfam:Ion_trans 1253 1306 5e-16 PFAM
Pfam:Ion_trans 1303 1503 2.5e-56 PFAM
Blast:EFh 1524 1552 5e-9 BLAST
Ca_chan_IQ 1638 1672 2.5e-19 SMART
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189520
AA Change: D2123E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140220
Gene: ENSMUSG00000051331
AA Change: D2123E

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 7e-50 PFAM
Pfam:PKD_channel 1229 1499 2.2e-9 PFAM
Pfam:Ion_trans 1253 1305 6.6e-16 PFAM
Pfam:Ion_trans 1301 1492 1.1e-56 PFAM
Blast:EFh 1513 1541 5e-9 BLAST
Ca_chan_IQ 1627 1661 2.5e-19 SMART
low complexity region 1781 1791 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190285
AA Change: D2161E

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141015
Gene: ENSMUSG00000051331
AA Change: D2161E

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Ion_trans 191 434 4e-58 PFAM
PDB:4DEY|B 435 558 2e-57 PDB
low complexity region 559 573 N/A INTRINSIC
transmembrane domain 579 598 N/A INTRINSIC
Pfam:Ion_trans 613 807 1.5e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 900 907 N/A INTRINSIC
transmembrane domain 951 973 N/A INTRINSIC
Pfam:Ion_trans 990 1220 3e-49 PFAM
Pfam:PKD_channel 1285 1537 1.4e-7 PFAM
Pfam:Ion_trans 1308 1530 4.4e-68 PFAM
Blast:EFh 1551 1579 5e-9 BLAST
Ca_chan_IQ 1665 1699 2.5e-19 SMART
low complexity region 1819 1829 N/A INTRINSIC
low complexity region 1999 2013 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191196
Predicted Effect probably benign
Transcript: ENSMUST00000219018
AA Change: D1947E

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219223
AA Change: D1936E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000219833
AA Change: D1972E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000220022
AA Change: D2030E

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for mutations that inactivate the gene do not survive to term. Selective ablation in beta cells resulted in impaired insulin secretion and systemic glucose intolerance. Heterozygotes were hypoactive, showed increased anxiety, and poor motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Cacna1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cacna1c APN 6 118676444 splice site probably benign
IGL00990:Cacna1c APN 6 118613295 missense probably damaging 1.00
IGL01352:Cacna1c APN 6 118656557 nonsense probably null
IGL01922:Cacna1c APN 6 118652668 missense probably damaging 0.99
IGL02008:Cacna1c APN 6 118715924 missense probably null 0.25
IGL02049:Cacna1c APN 6 118603919 missense probably benign 0.34
IGL02320:Cacna1c APN 6 118637792 missense probably damaging 1.00
IGL02375:Cacna1c APN 6 118675923 missense probably damaging 1.00
IGL02454:Cacna1c APN 6 118602180 missense probably damaging 1.00
IGL02544:Cacna1c APN 6 118751479 missense probably damaging 1.00
IGL02648:Cacna1c APN 6 118757496 missense probably damaging 1.00
IGL03191:Cacna1c APN 6 118741903 missense probably damaging 1.00
R0041:Cacna1c UTSW 6 118594027 missense probably damaging 0.99
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0083:Cacna1c UTSW 6 118625523 missense probably damaging 1.00
R0131:Cacna1c UTSW 6 118625512 missense probably damaging 1.00
R0142:Cacna1c UTSW 6 118603882 missense probably damaging 1.00
R0193:Cacna1c UTSW 6 118602402 splice site probably benign
R0245:Cacna1c UTSW 6 118604454 missense probably benign 0.10
R0394:Cacna1c UTSW 6 118625497 missense probably damaging 1.00
R0555:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0617:Cacna1c UTSW 6 118602213 missense probably damaging 1.00
R0652:Cacna1c UTSW 6 118602229 missense probably damaging 1.00
R0730:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0812:Cacna1c UTSW 6 118630263 missense probably benign 0.07
R0828:Cacna1c UTSW 6 118757386 missense probably benign 0.24
R0837:Cacna1c UTSW 6 118630270 nonsense probably null
R0881:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0882:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0924:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R0930:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R1157:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1158:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1159:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1160:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1237:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1238:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1239:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1337:Cacna1c UTSW 6 118627455 missense probably damaging 1.00
R1433:Cacna1c UTSW 6 118652793 nonsense probably null
R1517:Cacna1c UTSW 6 118598759 missense probably benign 0.01
R1619:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1704:Cacna1c UTSW 6 118602146 missense probably benign 0.01
R1739:Cacna1c UTSW 6 118610544 missense probably damaging 0.99
R1804:Cacna1c UTSW 6 118687046 missense probably damaging 1.00
R1889:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1891:Cacna1c UTSW 6 118776519 missense probably damaging 1.00
R1895:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1944:Cacna1c UTSW 6 118606266 missense probably damaging 1.00
R1961:Cacna1c UTSW 6 118630322 missense probably benign 0.05
R2043:Cacna1c UTSW 6 118596088 missense probably benign 0.01
R2045:Cacna1c UTSW 6 118656137 missense probably damaging 1.00
R2217:Cacna1c UTSW 6 118670407 missense probably damaging 1.00
R2237:Cacna1c UTSW 6 118652743 missense possibly damaging 0.94
R2509:Cacna1c UTSW 6 118734982 missense probably damaging 1.00
R3157:Cacna1c UTSW 6 118751524 missense probably benign 0.00
R3739:Cacna1c UTSW 6 118741952 missense probably benign
R3831:Cacna1c UTSW 6 118604463 missense probably benign 0.06
R4319:Cacna1c UTSW 6 118654369 missense probably damaging 1.00
R4477:Cacna1c UTSW 6 118630239 missense possibly damaging 0.48
R4571:Cacna1c UTSW 6 118630380 missense probably benign
R4671:Cacna1c UTSW 6 118652058 missense probably damaging 1.00
R4729:Cacna1c UTSW 6 118656175 missense probably damaging 1.00
R4741:Cacna1c UTSW 6 118613310 missense probably damaging 1.00
R4798:Cacna1c UTSW 6 118630302 nonsense probably null
R4803:Cacna1c UTSW 6 118751541 missense probably damaging 0.99
R4821:Cacna1c UTSW 6 118696425 missense probably damaging 1.00
R4888:Cacna1c UTSW 6 118751439 missense probably damaging 1.00
R4981:Cacna1c UTSW 6 118751471 missense probably benign 0.00
R5253:Cacna1c UTSW 6 118597969 missense probably benign 0.01
R5297:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5345:Cacna1c UTSW 6 118656536 critical splice donor site probably null
R5364:Cacna1c UTSW 6 118656543 missense probably benign 0.35
R5439:Cacna1c UTSW 6 118654372 missense probably damaging 1.00
R5472:Cacna1c UTSW 6 118638446 missense possibly damaging 0.86
R5516:Cacna1c UTSW 6 119057218 missense probably damaging 1.00
R5590:Cacna1c UTSW 6 118687182 missense probably damaging 1.00
R5619:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5684:Cacna1c UTSW 6 118687044 missense probably damaging 1.00
R5737:Cacna1c UTSW 6 118741932 missense probably damaging 1.00
R5768:Cacna1c UTSW 6 118697680 missense probably damaging 1.00
R5933:Cacna1c UTSW 6 118612580 missense probably damaging 1.00
R5965:Cacna1c UTSW 6 118602300 missense probably damaging 1.00
R6114:Cacna1c UTSW 6 118596140 missense probably benign 0.07
R6161:Cacna1c UTSW 6 119057302 missense probably damaging 1.00
R6267:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6267:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6296:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6296:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6307:Cacna1c UTSW 6 118613953 missense probably damaging 0.97
R6431:Cacna1c UTSW 6 118751373 missense probably damaging 1.00
R6467:Cacna1c UTSW 6 118652710 missense probably damaging 1.00
X0065:Cacna1c UTSW 6 118657376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTATCCCGACAGCAGTGAATG -3'
(R):5'- AAGTTCATCGAGGTCACCACCCAG -3'

Sequencing Primer
(F):5'- AAGACGCTGTTCCGGTTAC -3'
(R):5'- TCACCACCCAGGAGCTG -3'
Posted On2014-03-14