Incidental Mutation 'R1463:Cd163'
ID159220
Institutional Source Beutler Lab
Gene Symbol Cd163
Ensembl Gene ENSMUSG00000008845
Gene NameCD163 antigen
Synonyms
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location124304656-124330527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124311447 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 279 (E279G)
Ref Sequence ENSEMBL: ENSMUSP00000108160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032234] [ENSMUST00000112541]
Predicted Effect probably damaging
Transcript: ENSMUST00000032234
AA Change: E279G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032234
Gene: ENSMUSG00000008845
AA Change: E279G

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SR 50 150 1.1e-52 SMART
SR 157 258 1.4e-55 SMART
SR 265 365 7.3e-60 SMART
SR 372 472 1.2e-35 SMART
SR 477 577 2.3e-41 SMART
SR 582 682 9.8e-39 SMART
SR 719 819 1.1e-60 SMART
SR 824 927 4e-24 SMART
SR 930 1030 2.3e-55 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112541
AA Change: E279G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108160
Gene: ENSMUSG00000008845
AA Change: E279G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
SR 50 150 2.26e-50 SMART
SR 157 258 3.11e-53 SMART
SR 265 365 1.54e-57 SMART
SR 372 472 2.64e-33 SMART
SR 477 577 5.03e-39 SMART
SR 582 682 2.09e-36 SMART
SR 719 819 2.38e-58 SMART
SR 824 927 8.93e-22 SMART
SR 930 1030 5.06e-53 SMART
transmembrane domain 1046 1068 N/A INTRINSIC
low complexity region 1095 1107 N/A INTRINSIC
Meta Mutation Damage Score 0.41 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the scavenger receptor cysteine-rich (SRCR) superfamily, and is exclusively expressed in monocytes and macrophages. It functions as an acute phase-regulated receptor involved in the clearance and endocytosis of hemoglobin/haptoglobin complexes by macrophages, and may thereby protect tissues from free hemoglobin-mediated oxidative damage. This protein may also function as an innate immune sensor for bacteria and inducer of local inflammation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: After hindlimb ischemia, mice homozygous for a knock-out allele exhibit increased muscle satellite cell proliferation, and enhanced skeletal muscle regeneration not limited to the site of injury. Knock-out mice also exhibit increased eosinophilic airway inflammation in house dust mite-challenged. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Cd163
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Cd163 APN 6 124329101 splice site probably benign
IGL00755:Cd163 APN 6 124318657 missense possibly damaging 0.70
IGL01690:Cd163 APN 6 124307318 missense possibly damaging 0.89
IGL02101:Cd163 APN 6 124307287 nonsense probably null
IGL02733:Cd163 APN 6 124325341 missense probably damaging 1.00
IGL02801:Cd163 APN 6 124320529 missense probably benign 0.00
IGL02897:Cd163 APN 6 124325527 missense probably damaging 1.00
IGL03074:Cd163 APN 6 124317986 missense probably benign 0.00
IGL03283:Cd163 APN 6 124309199 missense possibly damaging 0.49
hottish UTSW 6 124309208 missense probably damaging 1.00
R0494:Cd163 UTSW 6 124311449 missense probably damaging 1.00
R0554:Cd163 UTSW 6 124312660 missense probably benign 0.03
R0622:Cd163 UTSW 6 124317352 missense probably damaging 1.00
R1004:Cd163 UTSW 6 124325347 missense probably damaging 1.00
R1061:Cd163 UTSW 6 124309169 missense probably benign 0.00
R1132:Cd163 UTSW 6 124309096 nonsense probably null
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1195:Cd163 UTSW 6 124325250 splice site probably benign
R1436:Cd163 UTSW 6 124327931 missense possibly damaging 0.47
R1532:Cd163 UTSW 6 124312730 missense possibly damaging 0.91
R1541:Cd163 UTSW 6 124327961 missense probably benign
R1654:Cd163 UTSW 6 124317581 missense probably damaging 1.00
R1717:Cd163 UTSW 6 124329588 utr 3 prime probably benign
R1744:Cd163 UTSW 6 124307028 missense possibly damaging 0.94
R2014:Cd163 UTSW 6 124325498 missense probably damaging 0.99
R2035:Cd163 UTSW 6 124320629 missense probably damaging 0.97
R2095:Cd163 UTSW 6 124317822 missense probably damaging 1.00
R2124:Cd163 UTSW 6 124318856 missense probably damaging 1.00
R2146:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R2353:Cd163 UTSW 6 124319156 nonsense probably null
R3854:Cd163 UTSW 6 124311566 missense probably damaging 1.00
R4425:Cd163 UTSW 6 124327903 missense possibly damaging 0.94
R4631:Cd163 UTSW 6 124329086 makesense probably null
R4647:Cd163 UTSW 6 124320621 missense probably damaging 1.00
R4713:Cd163 UTSW 6 124317618 critical splice donor site probably null
R4803:Cd163 UTSW 6 124312430 missense probably damaging 0.99
R4996:Cd163 UTSW 6 124319147 missense probably benign 0.00
R5022:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5023:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5032:Cd163 UTSW 6 124311669 missense probably damaging 1.00
R5057:Cd163 UTSW 6 124325288 missense probably damaging 0.97
R5121:Cd163 UTSW 6 124317989 missense probably damaging 1.00
R5436:Cd163 UTSW 6 124327964 missense probably benign
R5453:Cd163 UTSW 6 124312541 missense probably damaging 1.00
R5723:Cd163 UTSW 6 124319063 missense probably benign 0.00
R5929:Cd163 UTSW 6 124326609 critical splice donor site probably null
R5943:Cd163 UTSW 6 124329602 makesense probably null
R5964:Cd163 UTSW 6 124326572 missense probably benign 0.01
R5966:Cd163 UTSW 6 124320636 nonsense probably null
R6279:Cd163 UTSW 6 124317991 nonsense probably null
R6300:Cd163 UTSW 6 124317991 nonsense probably null
R6499:Cd163 UTSW 6 124304744 missense probably benign 0.00
R6602:Cd163 UTSW 6 124311635 missense probably damaging 1.00
R6708:Cd163 UTSW 6 124309208 missense probably damaging 1.00
R6767:Cd163 UTSW 6 124304779 missense possibly damaging 0.56
R6979:Cd163 UTSW 6 124317986 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCCTTGCAGATGCACATCTAC -3'
(R):5'- CCAAAGAGTTGCCTCATGTCCTTCG -3'

Sequencing Primer
(F):5'- ATAGAACCATAGAATGGCTACCTC -3'
(R):5'- CGCATGAAATGTTGTCAAGCC -3'
Posted On2014-03-14