Incidental Mutation 'R1463:Mmp21'
ID159229
Institutional Source Beutler Lab
Gene Symbol Mmp21
Ensembl Gene ENSMUSG00000030981
Gene Namematrix metallopeptidase 21
Synonyms
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location133674270-133680061 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 133675859 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033278] [ENSMUST00000051169] [ENSMUST00000122136] [ENSMUST00000128901]
Predicted Effect probably null
Transcript: ENSMUST00000033278
SMART Domains Protein: ENSMUSP00000033278
Gene: ENSMUSG00000030981

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 5.6e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
HX 332 390 1.97e-1 SMART
HX 393 448 5.36e-6 SMART
HX 450 497 9.33e-6 SMART
HX 505 548 1.11e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051169
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122136
SMART Domains Protein: ENSMUSP00000113853
Gene: ENSMUSG00000030981

DomainStartEndE-ValueType
Pfam:PG_binding_1 46 107 1.9e-13 PFAM
low complexity region 117 133 N/A INTRINSIC
ZnMc 166 327 2.67e-32 SMART
Pfam:Hemopexin 351 390 4.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128901
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137338
Predicted Effect probably benign
Transcript: ENSMUST00000176661
SMART Domains Protein: ENSMUSP00000134967
Gene: ENSMUSG00000039990

DomainStartEndE-ValueType
low complexity region 116 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211072
Meta Mutation Damage Score 0.6304 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. Mice harboring certain mutations in this gene exhibit congenital heart defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit heterotaxia and congenital cardiovascular defects including d-loop transposition of the great arteries, tricupid valve atresia, and ventricular septal defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Mmp21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Mmp21 APN 7 133675914 missense probably damaging 1.00
IGL02822:Mmp21 APN 7 133676099 missense possibly damaging 0.80
IGL03240:Mmp21 APN 7 133674571 missense probably damaging 0.97
IGL03261:Mmp21 APN 7 133674674 missense probably benign 0.01
R0659:Mmp21 UTSW 7 133677667 splice site probably benign
R1037:Mmp21 UTSW 7 133674453 missense probably benign 0.16
R1523:Mmp21 UTSW 7 133679045 missense probably benign
R1710:Mmp21 UTSW 7 133677285 missense probably damaging 1.00
R1804:Mmp21 UTSW 7 133678882 missense probably benign 0.01
R1848:Mmp21 UTSW 7 133677153 missense probably benign 0.05
R2993:Mmp21 UTSW 7 133678986 missense probably damaging 1.00
R3431:Mmp21 UTSW 7 133678750 missense probably benign 0.00
R4790:Mmp21 UTSW 7 133675030 missense probably damaging 1.00
R4870:Mmp21 UTSW 7 133678677 missense probably damaging 1.00
R5134:Mmp21 UTSW 7 133679013 missense probably benign 0.00
R5347:Mmp21 UTSW 7 133675922 missense probably benign
R5682:Mmp21 UTSW 7 133674629 missense probably benign 0.00
R5905:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6028:Mmp21 UTSW 7 133678714 missense probably benign 0.17
R6936:Mmp21 UTSW 7 133678975 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTCTCACAGTGAAAGCCATGAAC -3'
(R):5'- TCAACACGTACTTCTTCCGCAACAG -3'

Sequencing Primer
(F):5'- TGAACACCACGGAGTATCTTG -3'
(R):5'- TACTGGCTCTACGAAAACCG -3'
Posted On2014-03-14