Incidental Mutation 'R1463:Muc5b'
ID159230
Institutional Source Beutler Lab
Gene Symbol Muc5b
Ensembl Gene ENSMUSG00000066108
Gene Namemucin 5, subtype B, tracheobronchial
SynonymsMUC5, MUC9, 2300002I04Rik
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141839070-141873084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141859080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1921 (V1921A)
Ref Sequence ENSEMBL: ENSMUSP00000128276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165147]
Predicted Effect unknown
Transcript: ENSMUST00000165147
AA Change: V1921A
SMART Domains Protein: ENSMUSP00000128276
Gene: ENSMUSG00000066108
AA Change: V1921A

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWD 73 228 1.12e-25 SMART
C8 267 330 7.26e-8 SMART
Pfam:TIL 333 389 1.1e-13 PFAM
VWC 391 459 1.35e-1 SMART
VWD 418 582 2.87e-37 SMART
C8 619 693 2.53e-30 SMART
Pfam:TIL 699 756 2.6e-10 PFAM
VWC 758 823 1.26e0 SMART
VWC 861 930 1.58e-7 SMART
VWD 888 1048 3e-40 SMART
C8 1084 1158 3.75e-33 SMART
low complexity region 1314 1328 N/A INTRINSIC
Pfam:Mucin2_WxxW 1345 1432 6.7e-27 PFAM
low complexity region 1447 1468 N/A INTRINSIC
low complexity region 1498 1517 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
Pfam:Mucin2_WxxW 1574 1663 2.1e-26 PFAM
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1728 1745 N/A INTRINSIC
low complexity region 1778 1831 N/A INTRINSIC
Pfam:Mucin2_WxxW 1870 1959 2.7e-26 PFAM
low complexity region 1967 1990 N/A INTRINSIC
low complexity region 2024 2041 N/A INTRINSIC
low complexity region 2074 2127 N/A INTRINSIC
Pfam:Mucin2_WxxW 2184 2273 2.1e-26 PFAM
low complexity region 2281 2304 N/A INTRINSIC
low complexity region 2338 2355 N/A INTRINSIC
low complexity region 2388 2441 N/A INTRINSIC
Pfam:Mucin2_WxxW 2498 2587 2.1e-26 PFAM
low complexity region 2596 2618 N/A INTRINSIC
low complexity region 2623 2654 N/A INTRINSIC
low complexity region 2660 2681 N/A INTRINSIC
Pfam:Mucin2_WxxW 2687 2776 3.8e-25 PFAM
low complexity region 2781 2796 N/A INTRINSIC
low complexity region 2958 3009 N/A INTRINSIC
Pfam:Mucin2_WxxW 3066 3155 2.6e-26 PFAM
low complexity region 3220 3237 N/A INTRINSIC
low complexity region 3270 3317 N/A INTRINSIC
Pfam:Mucin2_WxxW 3380 3469 3.4e-26 PFAM
low complexity region 3509 3529 N/A INTRINSIC
low complexity region 3546 3562 N/A INTRINSIC
low complexity region 3568 3591 N/A INTRINSIC
Pfam:Mucin2_WxxW 3624 3713 2.6e-27 PFAM
Pfam:Mucin2_WxxW 3778 3867 3.2e-24 PFAM
low complexity region 3883 3900 N/A INTRINSIC
low complexity region 3910 3934 N/A INTRINSIC
low complexity region 3959 3976 N/A INTRINSIC
low complexity region 4033 4053 N/A INTRINSIC
VWD 4111 4283 6.75e-34 SMART
C8 4336 4403 4.26e-14 SMART
VWC 4461 4530 7.06e-5 SMART
VWC 4570 4631 6.53e-9 SMART
CT 4708 4790 2.93e-26 SMART
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele accumulate materials in the upper and lower airways leading to chronic infection and inflammation that does not resolve and results in premature death. Macrophage function is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Muc5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Muc5b APN 7 141841392 missense unknown
IGL00677:Muc5b APN 7 141857894 nonsense probably null
IGL00740:Muc5b APN 7 141855598 missense unknown
IGL01084:Muc5b APN 7 141843449 splice site probably benign
IGL01384:Muc5b APN 7 141846818 missense unknown
IGL01447:Muc5b APN 7 141863094 missense probably benign 0.01
IGL01510:Muc5b APN 7 141859061 missense unknown
IGL01532:Muc5b APN 7 141870006 missense possibly damaging 0.96
IGL01556:Muc5b APN 7 141863240 missense probably benign 0.01
IGL01608:Muc5b APN 7 141846437 missense unknown
IGL01884:Muc5b APN 7 141868083 splice site probably benign
IGL01943:Muc5b APN 7 141861497 missense possibly damaging 0.71
IGL02039:Muc5b APN 7 141871164 missense possibly damaging 0.96
IGL02089:Muc5b APN 7 141863250 missense probably benign 0.04
IGL02110:Muc5b APN 7 141847716 nonsense probably null
IGL02123:Muc5b APN 7 141863757 missense possibly damaging 0.68
IGL02124:Muc5b APN 7 141855632 missense unknown
IGL02141:Muc5b APN 7 141853367 missense unknown
IGL02409:Muc5b APN 7 141861338 missense possibly damaging 0.53
IGL02448:Muc5b APN 7 141868489 missense possibly damaging 0.53
IGL02503:Muc5b APN 7 141867667 missense probably benign 0.33
IGL02504:Muc5b APN 7 141846440 missense unknown
IGL02528:Muc5b APN 7 141864017 missense probably benign 0.01
IGL02534:Muc5b APN 7 141844719 missense unknown
IGL02565:Muc5b APN 7 141857867 missense unknown
IGL02630:Muc5b APN 7 141863231 missense probably benign 0.03
IGL02881:Muc5b APN 7 141857712 missense unknown
IGL02963:Muc5b APN 7 141864264 missense probably damaging 1.00
IGL03003:Muc5b APN 7 141863614 missense probably benign 0.03
IGL03013:Muc5b APN 7 141863928 missense possibly damaging 0.68
IGL03102:Muc5b APN 7 141863069 missense probably benign 0.35
IGL03114:Muc5b APN 7 141858819 nonsense probably null
IGL03150:Muc5b APN 7 141865509 missense possibly damaging 0.53
IGL03185:Muc5b APN 7 141862822 missense possibly damaging 0.83
IGL03299:Muc5b APN 7 141841380 missense unknown
IGL03336:Muc5b APN 7 141864363 missense probably damaging 1.00
IGL03370:Muc5b APN 7 141864777 missense probably benign 0.34
IGL03375:Muc5b APN 7 141861962 missense possibly damaging 0.53
IGL03393:Muc5b APN 7 141864138 missense probably benign 0.21
R0045:Muc5b UTSW 7 141856818 missense unknown
R0256:Muc5b UTSW 7 141841395 missense unknown
R0256:Muc5b UTSW 7 141843258 missense unknown
R0321:Muc5b UTSW 7 141862235 missense probably benign 0.19
R0391:Muc5b UTSW 7 141865082 missense possibly damaging 0.73
R0458:Muc5b UTSW 7 141864972 missense probably benign 0.20
R0491:Muc5b UTSW 7 141862015 missense probably benign 0.01
R0543:Muc5b UTSW 7 141851785 missense unknown
R0583:Muc5b UTSW 7 141856698 nonsense probably null
R0611:Muc5b UTSW 7 141862436 missense probably benign 0.18
R0625:Muc5b UTSW 7 141846427 missense unknown
R0655:Muc5b UTSW 7 141863942 missense probably benign 0.01
R0845:Muc5b UTSW 7 141850446 splice site probably null
R0863:Muc5b UTSW 7 141867717 missense probably benign 0.18
R0965:Muc5b UTSW 7 141863802 missense possibly damaging 0.92
R0988:Muc5b UTSW 7 141871795 missense probably benign 0.03
R1140:Muc5b UTSW 7 141858996 missense unknown
R1209:Muc5b UTSW 7 141857910 missense unknown
R1333:Muc5b UTSW 7 141868407 missense possibly damaging 0.53
R1337:Muc5b UTSW 7 141858624 missense unknown
R1385:Muc5b UTSW 7 141862137 missense probably benign 0.00
R1471:Muc5b UTSW 7 141843234 missense unknown
R1617:Muc5b UTSW 7 141863524 nonsense probably null
R1736:Muc5b UTSW 7 141859107 missense unknown
R1752:Muc5b UTSW 7 141867751 missense possibly damaging 0.96
R1804:Muc5b UTSW 7 141863780 missense possibly damaging 0.68
R1806:Muc5b UTSW 7 141865493 missense possibly damaging 0.68
R1895:Muc5b UTSW 7 141857645 missense unknown
R1902:Muc5b UTSW 7 141864105 missense possibly damaging 0.77
R1919:Muc5b UTSW 7 141846031 missense unknown
R1924:Muc5b UTSW 7 141868223 missense possibly damaging 0.53
R1942:Muc5b UTSW 7 141857684 missense unknown
R1959:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1960:Muc5b UTSW 7 141862637 missense possibly damaging 0.86
R1976:Muc5b UTSW 7 141863154 missense probably benign 0.01
R2080:Muc5b UTSW 7 141869754 missense probably benign 0.33
R2178:Muc5b UTSW 7 141864116 missense possibly damaging 0.58
R2184:Muc5b UTSW 7 141858864 nonsense probably null
R2229:Muc5b UTSW 7 141861644 missense possibly damaging 0.71
R2237:Muc5b UTSW 7 141862089 missense probably benign 0.00
R2509:Muc5b UTSW 7 141859061 missense unknown
R2510:Muc5b UTSW 7 141859061 missense unknown
R2512:Muc5b UTSW 7 141859076 missense unknown
R2888:Muc5b UTSW 7 141861554 missense probably damaging 0.98
R3054:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3055:Muc5b UTSW 7 141864041 missense probably damaging 0.97
R3108:Muc5b UTSW 7 141858759 missense unknown
R3109:Muc5b UTSW 7 141858759 missense unknown
R3113:Muc5b UTSW 7 141846134 missense unknown
R3551:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141861335 missense possibly damaging 0.53
R3552:Muc5b UTSW 7 141867705 missense probably benign 0.18
R3622:Muc5b UTSW 7 141851858 splice site probably benign
R3700:Muc5b UTSW 7 141847249 missense unknown
R3734:Muc5b UTSW 7 141859037 nonsense probably null
R3785:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3786:Muc5b UTSW 7 141865116 missense possibly damaging 0.86
R3788:Muc5b UTSW 7 141863834 missense possibly damaging 0.68
R3810:Muc5b UTSW 7 141864126 missense possibly damaging 0.58
R3834:Muc5b UTSW 7 141859181 missense unknown
R3835:Muc5b UTSW 7 141859181 missense unknown
R3850:Muc5b UTSW 7 141862638 missense possibly damaging 0.95
R3877:Muc5b UTSW 7 141857552 missense unknown
R3909:Muc5b UTSW 7 141849498 missense unknown
R3964:Muc5b UTSW 7 141866968 missense possibly damaging 0.73
R4014:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4015:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4017:Muc5b UTSW 7 141863630 missense probably benign 0.40
R4042:Muc5b UTSW 7 141864887 missense possibly damaging 0.92
R4200:Muc5b UTSW 7 141858925 nonsense probably null
R4230:Muc5b UTSW 7 141863522 missense probably benign 0.03
R4400:Muc5b UTSW 7 141861387 missense possibly damaging 0.92
R4455:Muc5b UTSW 7 141858818 missense unknown
R4484:Muc5b UTSW 7 141868450 missense possibly damaging 0.73
R4630:Muc5b UTSW 7 141857984 missense unknown
R4646:Muc5b UTSW 7 141862640 missense probably benign 0.34
R4658:Muc5b UTSW 7 141841398 missense unknown
R4667:Muc5b UTSW 7 141842379 missense unknown
R4690:Muc5b UTSW 7 141842294 missense unknown
R4697:Muc5b UTSW 7 141857361 missense unknown
R4711:Muc5b UTSW 7 141846033 missense unknown
R4713:Muc5b UTSW 7 141849079 nonsense probably null
R4749:Muc5b UTSW 7 141861448 nonsense probably null
R4753:Muc5b UTSW 7 141856853 missense unknown
R4782:Muc5b UTSW 7 141847716 nonsense probably null
R4795:Muc5b UTSW 7 141849567 missense unknown
R4796:Muc5b UTSW 7 141864246 missense possibly damaging 0.52
R4799:Muc5b UTSW 7 141847716 nonsense probably null
R4824:Muc5b UTSW 7 141864185 missense probably damaging 1.00
R4825:Muc5b UTSW 7 141868465 missense possibly damaging 0.96
R5068:Muc5b UTSW 7 141858608 missense unknown
R5073:Muc5b UTSW 7 141859262 missense unknown
R5074:Muc5b UTSW 7 141859262 missense unknown
R5107:Muc5b UTSW 7 141855531 missense unknown
R5152:Muc5b UTSW 7 141865531 missense possibly damaging 0.53
R5183:Muc5b UTSW 7 141850810 missense unknown
R5191:Muc5b UTSW 7 141858539 missense unknown
R5254:Muc5b UTSW 7 141864540 missense probably benign 0.09
R5320:Muc5b UTSW 7 141859001 missense unknown
R5352:Muc5b UTSW 7 141864558 missense possibly damaging 0.66
R5378:Muc5b UTSW 7 141862203 missense unknown
R5417:Muc5b UTSW 7 141858044 missense unknown
R5548:Muc5b UTSW 7 141863942 missense probably benign 0.01
R5551:Muc5b UTSW 7 141868503 missense possibly damaging 0.73
R5562:Muc5b UTSW 7 141847238 missense unknown
R5580:Muc5b UTSW 7 141861347 missense possibly damaging 0.53
R5629:Muc5b UTSW 7 141861299 missense possibly damaging 0.73
R5758:Muc5b UTSW 7 141858983 missense unknown
R5783:Muc5b UTSW 7 141858428 nonsense probably null
R5795:Muc5b UTSW 7 141871741 missense possibly damaging 0.96
R5796:Muc5b UTSW 7 141857396 missense unknown
R5797:Muc5b UTSW 7 141851582 missense unknown
R5806:Muc5b UTSW 7 141862835 missense possibly damaging 0.68
R5888:Muc5b UTSW 7 141858421 missense unknown
R5910:Muc5b UTSW 7 141861311 missense possibly damaging 0.53
R5956:Muc5b UTSW 7 141864173 missense probably damaging 0.99
R5970:Muc5b UTSW 7 141856712 missense unknown
R5990:Muc5b UTSW 7 141858161 missense unknown
R5999:Muc5b UTSW 7 141857379 missense unknown
R6001:Muc5b UTSW 7 141872381 missense possibly damaging 0.72
R6053:Muc5b UTSW 7 141864708 missense probably benign 0.07
R6073:Muc5b UTSW 7 141849060 missense unknown
R6073:Muc5b UTSW 7 141858288 missense unknown
R6112:Muc5b UTSW 7 141863305 missense probably benign 0.01
R6153:Muc5b UTSW 7 141861444 missense possibly damaging 0.71
R6164:Muc5b UTSW 7 141863345 missense possibly damaging 0.73
R6172:Muc5b UTSW 7 141858776 missense unknown
R6178:Muc5b UTSW 7 141856342 missense probably null
R6196:Muc5b UTSW 7 141851596 missense unknown
R6213:Muc5b UTSW 7 141862166 missense probably benign 0.00
R6213:Muc5b UTSW 7 141867619 missense possibly damaging 0.92
R6344:Muc5b UTSW 7 141862971 missense possibly damaging 0.62
R6400:Muc5b UTSW 7 141858665 missense unknown
R6414:Muc5b UTSW 7 141859097 missense unknown
R6521:Muc5b UTSW 7 141859171 nonsense probably null
R6658:Muc5b UTSW 7 141868507 critical splice donor site probably null
R6717:Muc5b UTSW 7 141857822 nonsense probably null
R6737:Muc5b UTSW 7 141857499 missense unknown
R6763:Muc5b UTSW 7 141862284 missense probably benign 0.01
R6817:Muc5b UTSW 7 141862913 missense probably benign 0.06
R6819:Muc5b UTSW 7 141858863 missense unknown
R6916:Muc5b UTSW 7 141864717 missense possibly damaging 0.71
Z1088:Muc5b UTSW 7 141862214 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTCCAGCATGACAACCATCTCC -3'
(R):5'- GTAGTTTCTGTCGTTGAGACCGATCC -3'

Sequencing Primer
(F):5'- AGTCACTGAGACCCTGTCC -3'
(R):5'- GTTGAGACCGATCCTTCAGG -3'
Posted On2014-03-14