Incidental Mutation 'R1463:Abca5'
ID159246
Institutional Source Beutler Lab
Gene Symbol Abca5
Ensembl Gene ENSMUSG00000018800
Gene NameATP-binding cassette, sub-family A (ABC1), member 5
SynonymsABC13, B930033A02Rik
MMRRC Submission 039517-MU
Accession Numbers

NCBI RefSeq: NM_147219.2; MGI: 2386607

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110269369-110337716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110314558 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 299 (I299N)
Ref Sequence ENSEMBL: ENSMUSP00000120708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043961] [ENSMUST00000124714]
Predicted Effect probably damaging
Transcript: ENSMUST00000043961
AA Change: I299N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047927
Gene: ENSMUSG00000018800
AA Change: I299N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 29 416 4.3e-33 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
low complexity region 1262 1267 N/A INTRINSIC
AAA 1325 1512 3.52e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124714
AA Change: I299N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120708
Gene: ENSMUSG00000018800
AA Change: I299N

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 30 416 9.5e-32 PFAM
AAA 506 691 2.88e-8 SMART
low complexity region 733 744 N/A INTRINSIC
transmembrane domain 864 886 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1019 1041 N/A INTRINSIC
transmembrane domain 1074 1096 N/A INTRINSIC
transmembrane domain 1103 1125 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127318
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype Strain: 3581814
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24, but neither the substrate nor the function of this gene is known. Alternative splicing of this gene results in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit exophthalmos, tremors and collapse of the thyroid gland, and develop a dilated cardiomyopathy with large thrombi due to depression of the cardiac function. Severe edema, liver injury and premature death appear to be sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Abca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Abca5 APN 11 110309450 critical splice acceptor site probably null
IGL00675:Abca5 APN 11 110304985 missense probably damaging 1.00
IGL01512:Abca5 APN 11 110317823 missense probably benign 0.40
IGL01559:Abca5 APN 11 110272526 missense probably benign
IGL01584:Abca5 APN 11 110304923 missense probably damaging 0.98
IGL01604:Abca5 APN 11 110277636 missense possibly damaging 0.47
IGL01828:Abca5 APN 11 110287695 missense probably benign
IGL01880:Abca5 APN 11 110293263 missense probably benign 0.01
IGL02054:Abca5 APN 11 110292123 missense probably damaging 0.99
IGL02074:Abca5 APN 11 110293350 missense probably benign 0.00
IGL02233:Abca5 APN 11 110274344 nonsense probably null
IGL02245:Abca5 APN 11 110298169 nonsense probably null
IGL02317:Abca5 APN 11 110327761 missense probably benign 0.09
IGL02352:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02359:Abca5 APN 11 110275330 missense probably benign 0.01
IGL02390:Abca5 APN 11 110296551 missense probably benign
IGL02600:Abca5 APN 11 110309438 missense probably benign 0.02
IGL02639:Abca5 APN 11 110288073 missense possibly damaging 0.79
IGL03000:Abca5 APN 11 110317814 missense probably benign 0.04
IGL03074:Abca5 APN 11 110310275 missense probably benign 0.01
IGL03078:Abca5 APN 11 110276545 nonsense probably null
IGL03342:Abca5 APN 11 110287691 missense possibly damaging 0.94
IGL03368:Abca5 APN 11 110313522 splice site probably benign
atles UTSW 11 110299929 missense probably damaging 0.99
R0106:Abca5 UTSW 11 110319825 missense probably damaging 1.00
R0116:Abca5 UTSW 11 110276505 missense probably damaging 1.00
R0305:Abca5 UTSW 11 110273311 splice site probably benign
R0550:Abca5 UTSW 11 110293840 missense probably damaging 1.00
R0578:Abca5 UTSW 11 110276489 nonsense probably null
R0587:Abca5 UTSW 11 110311377 missense probably benign 0.00
R0610:Abca5 UTSW 11 110301527 missense probably benign 0.00
R0617:Abca5 UTSW 11 110279689 missense probably damaging 0.98
R0667:Abca5 UTSW 11 110327811 missense probably benign 0.00
R0844:Abca5 UTSW 11 110319832 missense probably benign 0.00
R1273:Abca5 UTSW 11 110326665 missense probably benign 0.01
R1511:Abca5 UTSW 11 110299978 missense probably damaging 1.00
R1511:Abca5 UTSW 11 110299986 missense possibly damaging 0.73
R1687:Abca5 UTSW 11 110293888 missense probably benign 0.32
R1759:Abca5 UTSW 11 110293848 missense probably benign
R1870:Abca5 UTSW 11 110329217 missense probably benign 0.33
R2006:Abca5 UTSW 11 110313449 missense probably benign
R2039:Abca5 UTSW 11 110299929 missense probably damaging 0.99
R2076:Abca5 UTSW 11 110287652 missense probably benign 0.10
R2136:Abca5 UTSW 11 110319832 missense probably benign 0.00
R2154:Abca5 UTSW 11 110292174 missense probably benign 0.00
R2273:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2274:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2275:Abca5 UTSW 11 110275281 missense possibly damaging 0.93
R2328:Abca5 UTSW 11 110276521 missense probably damaging 0.99
R3702:Abca5 UTSW 11 110288058 splice site probably null
R3768:Abca5 UTSW 11 110313391 missense probably benign 0.01
R3872:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3873:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3874:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R3875:Abca5 UTSW 11 110310233 missense probably damaging 1.00
R4347:Abca5 UTSW 11 110299968 missense probably damaging 1.00
R4429:Abca5 UTSW 11 110311410 missense probably benign 0.00
R4790:Abca5 UTSW 11 110311410 missense possibly damaging 0.63
R4812:Abca5 UTSW 11 110301821 missense probably damaging 1.00
R4833:Abca5 UTSW 11 110279316 missense probably benign 0.00
R4883:Abca5 UTSW 11 110326631 missense probably damaging 1.00
R5000:Abca5 UTSW 11 110310224 missense probably damaging 1.00
R5004:Abca5 UTSW 11 110279376 missense probably damaging 0.99
R5066:Abca5 UTSW 11 110309350 intron probably benign
R5230:Abca5 UTSW 11 110319860 missense probably benign
R5321:Abca5 UTSW 11 110327825 missense probably benign
R5350:Abca5 UTSW 11 110319796 nonsense probably null
R5414:Abca5 UTSW 11 110314622 missense probably damaging 1.00
R5437:Abca5 UTSW 11 110319796 nonsense probably null
R5451:Abca5 UTSW 11 110319796 nonsense probably null
R5453:Abca5 UTSW 11 110319796 nonsense probably null
R5488:Abca5 UTSW 11 110292183 missense probably benign 0.00
R5636:Abca5 UTSW 11 110301536 missense probably benign 0.00
R5805:Abca5 UTSW 11 110279390 missense probably benign 0.06
R5900:Abca5 UTSW 11 110279156 missense possibly damaging 0.92
R6152:Abca5 UTSW 11 110313361 missense probably damaging 1.00
R6167:Abca5 UTSW 11 110292105 missense probably benign 0.10
R6343:Abca5 UTSW 11 110314552 missense probably damaging 1.00
R6425:Abca5 UTSW 11 110329232 missense possibly damaging 0.75
R6493:Abca5 UTSW 11 110293878 missense probably benign 0.00
R6498:Abca5 UTSW 11 110292102 missense possibly damaging 0.70
R6884:Abca5 UTSW 11 110329217 missense probably damaging 0.96
R6912:Abca5 UTSW 11 110306280 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- ACAGTGTGCAACCTTTCACAGGAC -3'
(R):5'- TTGGGTGCATGAACACACGCAG -3'

Sequencing Primer
(F):5'- GTGCAACCTTTCACAGGACAAATAG -3'
(R):5'- GCATGAACACACGCAGATAAATTG -3'
Posted On2014-03-14