Incidental Mutation 'R1463:Cacna1i'
ID159263
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Namecalcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80287238-80398279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80379054 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1440 (H1440R)
Ref Sequence ENSEMBL: ENSMUSP00000125229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000160424
AA Change: H1440R

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: H1440R

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162155
AA Change: H1440R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: H1440R

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80382019 missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80355645 missense probably benign
IGL01338:Cacna1i APN 15 80348380 missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80387759 splice site probably benign
IGL01669:Cacna1i APN 15 80391757 missense probably benign
IGL01807:Cacna1i APN 15 80374147 missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80391732 missense probably benign 0.09
IGL01973:Cacna1i APN 15 80382033 missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80372951 missense probably benign 0.06
IGL02519:Cacna1i APN 15 80361874 nonsense probably null
IGL02648:Cacna1i APN 15 80298638 missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80362239 missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80355716 missense probably benign 0.30
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80356211 missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80372462 missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80368830 splice site probably benign
R0637:Cacna1i UTSW 15 80372654 missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80381080 missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80358949 missense possibly damaging 0.85
R1528:Cacna1i UTSW 15 80391774 splice site probably null
R1563:Cacna1i UTSW 15 80321188 missense probably damaging 0.97
R1563:Cacna1i UTSW 15 80389855 splice site probably benign
R1573:Cacna1i UTSW 15 80393668 splice site probably null
R1654:Cacna1i UTSW 15 80389210 missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80371529 missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80389122 missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80376789 missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80358931 missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80391642 missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80375264 missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80395044 missense probably benign
R2162:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80374767 missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80381071 splice site probably benign
R3702:Cacna1i UTSW 15 80381071 splice site probably benign
R3832:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80388479 missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80369662 missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80368671 missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80348449 missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80390840 missense possibly damaging 0.94
R5437:Cacna1i UTSW 15 80371529 missense probably damaging 1.00
R5519:Cacna1i UTSW 15 80371499 missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80395078 missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80389132 missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80321226 missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80336682 missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80355758 missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80378247 missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80321259 missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80374809 missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80374801 missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80361962 missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80362139 missense probably benign 0.03
X0058:Cacna1i UTSW 15 80379102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAGAACACACCCGCCCCTTATG -3'
(R):5'- TGGACGCTGACCCTCTACTCAATC -3'

Sequencing Primer
(F):5'- AGTTTTGGGGTCAATCATCCAC -3'
(R):5'- TCAATCCTCAACCTGAGGTGG -3'
Posted On2014-03-14