Incidental Mutation 'R1463:Gbf1'
ID159280
Institutional Source Beutler Lab
Gene Symbol Gbf1
Ensembl Gene ENSMUSG00000025224
Gene Namegolgi-specific brefeldin A-resistance factor 1
Synonyms1700083E03Rik
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R1463 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46152509-46286510 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 46271545 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000026254] [ENSMUST00000176992]
Predicted Effect probably benign
Transcript: ENSMUST00000026254
SMART Domains Protein: ENSMUSP00000026254
Gene: ENSMUSG00000025224

DomainStartEndE-ValueType
low complexity region 270 288 N/A INTRINSIC
Pfam:Sec7_N 400 551 3.4e-29 PFAM
Sec7 696 884 8.55e-91 SMART
low complexity region 1198 1216 N/A INTRINSIC
low complexity region 1281 1296 N/A INTRINSIC
low complexity region 1773 1793 N/A INTRINSIC
low complexity region 1802 1820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176853
Predicted Effect probably benign
Transcript: ENSMUST00000176992
SMART Domains Protein: ENSMUSP00000135062
Gene: ENSMUSG00000025224

DomainStartEndE-ValueType
low complexity region 216 234 N/A INTRINSIC
Pfam:Sec7_N 343 498 1.5e-35 PFAM
Sec7 642 830 8.55e-91 SMART
low complexity region 1144 1162 N/A INTRINSIC
low complexity region 1227 1242 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1744 1762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177406
Predicted Effect probably benign
Transcript: ENSMUST00000177512
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Sec7 domain family. The encoded protein is a guanine nucleotide exchange factor that regulates the recruitment of proteins to membranes by mediating GDP to GTP exchange. The encoded protein is localized to the Golgi apparatus and plays a role in vesicular trafficking by activating ADP ribosylation factor 1. The encoded protein has also been identified as an important host factor for viral replication. Multiple transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
Afap1l2 T A 19: 56,930,151 M117L probably benign Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Gbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Gbf1 APN 19 46284249 critical splice acceptor site probably null
IGL00988:Gbf1 APN 19 46284120 critical splice donor site probably null
IGL01352:Gbf1 APN 19 46265215 missense probably damaging 1.00
IGL01432:Gbf1 APN 19 46279995 missense probably damaging 1.00
IGL01469:Gbf1 APN 19 46279364 missense probably damaging 1.00
IGL01870:Gbf1 APN 19 46285669 missense probably benign 0.00
IGL02019:Gbf1 APN 19 46279292 missense possibly damaging 0.93
IGL02061:Gbf1 APN 19 46279258 missense possibly damaging 0.65
IGL02126:Gbf1 APN 19 46252117 missense probably damaging 0.97
IGL02272:Gbf1 APN 19 46269803 missense probably damaging 1.00
IGL02346:Gbf1 APN 19 46285930 missense probably damaging 1.00
IGL02491:Gbf1 APN 19 46262540 unclassified probably benign
IGL03003:Gbf1 APN 19 46255655 missense probably damaging 1.00
IGL03130:Gbf1 APN 19 46267348 missense possibly damaging 0.82
IGL03376:Gbf1 APN 19 46262521 missense possibly damaging 0.94
R0107:Gbf1 UTSW 19 46284828 missense probably benign
R0139:Gbf1 UTSW 19 46261792 missense probably damaging 1.00
R0180:Gbf1 UTSW 19 46285722 missense probably benign
R0255:Gbf1 UTSW 19 46254110 splice site probably benign
R0317:Gbf1 UTSW 19 46254020 missense probably benign
R0329:Gbf1 UTSW 19 46272270 critical splice donor site probably null
R0372:Gbf1 UTSW 19 46285704 missense probably benign
R0666:Gbf1 UTSW 19 46262544 unclassified probably benign
R1701:Gbf1 UTSW 19 46261675 missense probably damaging 1.00
R1848:Gbf1 UTSW 19 46272037 missense possibly damaging 0.90
R1962:Gbf1 UTSW 19 46267219 missense probably damaging 1.00
R1965:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R1966:Gbf1 UTSW 19 46271564 missense probably damaging 1.00
R2177:Gbf1 UTSW 19 46265670 missense probably benign
R2238:Gbf1 UTSW 19 46163618 missense probably benign
R2239:Gbf1 UTSW 19 46163618 missense probably benign
R2520:Gbf1 UTSW 19 46265367 missense probably benign
R3821:Gbf1 UTSW 19 46264807 missense probably damaging 0.99
R4681:Gbf1 UTSW 19 46280550 missense probably benign 0.41
R4695:Gbf1 UTSW 19 46259167 nonsense probably null
R4785:Gbf1 UTSW 19 46268395 missense possibly damaging 0.89
R5202:Gbf1 UTSW 19 46268454 missense probably benign 0.13
R5359:Gbf1 UTSW 19 46283725 critical splice donor site probably null
R5468:Gbf1 UTSW 19 46284296 missense possibly damaging 0.92
R5593:Gbf1 UTSW 19 46272524 missense possibly damaging 0.91
R5595:Gbf1 UTSW 19 46284422 missense possibly damaging 0.74
R5796:Gbf1 UTSW 19 46284343 missense probably benign 0.08
R5938:Gbf1 UTSW 19 46268452 missense probably damaging 1.00
R5957:Gbf1 UTSW 19 46246221 critical splice donor site probably null
R6059:Gbf1 UTSW 19 46265248 missense probably damaging 1.00
R6120:Gbf1 UTSW 19 46279321 missense possibly damaging 0.83
R6239:Gbf1 UTSW 19 46259696 missense probably benign 0.00
R6252:Gbf1 UTSW 19 46271556 missense probably benign 0.33
R6310:Gbf1 UTSW 19 46280005 missense probably damaging 0.96
R6787:Gbf1 UTSW 19 46271772 missense probably benign
R6805:Gbf1 UTSW 19 46262507 missense probably damaging 1.00
R6855:Gbf1 UTSW 19 46279941 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCACCTCTTAGAGGGGACACAGTAG -3'
(R):5'- TCAGGACCACTCAATGTCAGCCAG -3'

Sequencing Primer
(F):5'- gctcctgtctcagcctcc -3'
(R):5'- AGCTAAGAACTGTTGACTCTCC -3'
Posted On2014-03-14