Incidental Mutation 'R1463:Afap1l2'
ID159281
Institutional Source Beutler Lab
Gene Symbol Afap1l2
Ensembl Gene ENSMUSG00000025083
Gene Nameactin filament associated protein 1-like 2
Synonyms
MMRRC Submission 039517-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R1463 (G1)
Quality Score123
Status Validated
Chromosome19
Chromosomal Location56912361-57008228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56930151 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 117 (M117L)
Ref Sequence ENSEMBL: ENSMUSP00000123400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359] [ENSMUST00000126964] [ENSMUST00000148049] [ENSMUST00000225394]
Predicted Effect probably benign
Transcript: ENSMUST00000111584
AA Change: M191L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083
AA Change: M191L

DomainStartEndE-ValueType
Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118800
AA Change: M173L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083
AA Change: M173L

DomainStartEndE-ValueType
Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122359
AA Change: M117L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083
AA Change: M117L

DomainStartEndE-ValueType
Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126964
AA Change: M117L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123400
Gene: ENSMUSG00000025083
AA Change: M117L

DomainStartEndE-ValueType
Blast:PH 1 79 5e-36 BLAST
low complexity region 86 96 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148049
AA Change: M117L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000120490
Gene: ENSMUSG00000025083
AA Change: M117L

DomainStartEndE-ValueType
Blast:PH 1 79 2e-34 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155467
Predicted Effect probably benign
Transcript: ENSMUST00000225394
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency 97% (97/100)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,073 probably benign Het
4931408C20Rik G T 1: 26,682,141 Y1319* probably null Het
Abca5 A T 11: 110,314,558 I299N probably damaging Het
Abcc8 T C 7: 46,154,512 T413A probably benign Het
Actc1 G A 2: 114,049,529 S201F probably damaging Het
Adam30 G A 3: 98,162,525 C558Y probably damaging Het
Adcy4 T A 14: 55,778,939 I352F probably damaging Het
Adgrl4 A T 3: 151,510,596 D472V probably damaging Het
AI597479 T C 1: 43,113,229 V229A probably damaging Het
Ascc1 T C 10: 60,062,516 V267A probably benign Het
Asxl3 A G 18: 22,516,753 S600G possibly damaging Het
Atg14 T C 14: 47,548,994 I268V probably benign Het
Bcas1 C T 2: 170,418,664 V32I probably benign Het
Cacna1c G T 6: 118,593,994 D2106E probably benign Het
Cacna1i A G 15: 80,379,054 H1440R possibly damaging Het
Catsper2 G A 2: 121,406,446 T240M probably damaging Het
Cd163 A G 6: 124,311,447 E279G probably damaging Het
Cdx2 C T 5: 147,306,660 S108N probably benign Het
Cenpf A T 1: 189,654,739 N1781K probably damaging Het
Cgref1 T A 5: 30,935,994 probably benign Het
Clcn4 C T 7: 7,296,764 W22* probably null Het
Cntn2 A G 1: 132,521,137 probably null Het
Cntn5 C T 9: 9,673,796 probably null Het
Cpeb3 A G 19: 37,139,100 M377T probably benign Het
Cryge T A 1: 65,048,838 R135* probably null Het
Ctdsp2 C A 10: 126,993,921 probably benign Het
Ctsll3 G A 13: 60,801,275 probably benign Het
Cuzd1 C A 7: 131,316,642 G189C probably damaging Het
Dmbt1 T A 7: 131,109,637 probably null Het
Dnajc13 A T 9: 104,178,940 S1587R probably damaging Het
Dock4 GCTCAGTGTATC GC 12: 40,816,325 probably null Het
Dock6 T C 9: 21,831,906 H701R probably damaging Het
Edem3 A G 1: 151,807,510 T646A possibly damaging Het
Esrra A C 19: 6,912,455 D160E probably benign Het
Fbn2 T C 18: 58,010,380 T2868A probably benign Het
Galnt7 T A 8: 57,652,858 M41L probably benign Het
Gbf1 T C 19: 46,271,545 probably benign Het
Glyat A G 19: 12,648,103 N63S probably damaging Het
Gm9376 A T 14: 118,267,482 M109L probably benign Het
H2-M10.3 A G 17: 36,366,720 V222A probably damaging Het
Ifna12 T G 4: 88,602,956 D118A possibly damaging Het
Inpp5j T C 11: 3,501,147 M501V probably benign Het
Itpr3 C T 17: 27,117,154 probably benign Het
Ivns1abp A G 1: 151,361,540 N527S probably benign Het
Kif13a T C 13: 46,929,612 T4A possibly damaging Het
Kif3b T C 2: 153,330,153 *748Q probably null Het
Klf8 C T X: 153,384,681 Q241* probably null Het
Kras A T 6: 145,225,061 probably benign Het
Lamc3 C A 2: 31,887,411 T23K probably benign Het
Lrrc74b T A 16: 17,559,873 H47L probably benign Het
Ly75 A G 2: 60,368,757 probably null Het
Map3k21 G A 8: 125,942,137 G821S probably benign Het
Mettl14 A G 3: 123,374,073 probably benign Het
Mettl5 T C 2: 69,885,246 probably benign Het
Mier3 A G 13: 111,711,755 D301G probably damaging Het
Mipep T C 14: 60,788,146 probably benign Het
Mmp21 T C 7: 133,675,859 probably null Het
Msh4 A G 3: 153,857,570 L723P probably damaging Het
Muc5b T C 7: 141,859,080 V1921A unknown Het
Myo1e G A 9: 70,338,756 E410K possibly damaging Het
Nav2 T G 7: 49,535,962 I951S probably damaging Het
Npc1 G A 18: 12,191,830 T1202I probably damaging Het
Olfr1441 C T 19: 12,422,888 T193I probably benign Het
Olfr218 A G 1: 173,203,367 K4E probably benign Het
Olfr324 A G 11: 58,598,121 R242G probably damaging Het
Patl2 C T 2: 122,123,735 V452M probably benign Het
Pcdh18 A G 3: 49,755,405 V487A probably damaging Het
Pdzph1 C T 17: 58,932,445 A963T probably damaging Het
Pkd1l1 C T 11: 8,916,302 V518M probably damaging Het
Plcd3 A G 11: 103,078,373 F256S probably damaging Het
Proc T C 18: 32,133,438 D112G possibly damaging Het
Ptges2 T A 2: 32,400,862 probably null Het
Pth2r A T 1: 65,363,277 R312W probably damaging Het
Rbbp6 C T 7: 122,992,453 H546Y possibly damaging Het
Retreg2 A G 1: 75,146,520 E364G probably damaging Het
Rxrb G A 17: 34,034,160 C185Y probably damaging Het
Sept2 T A 1: 93,499,315 N133K possibly damaging Het
Serpina3b T A 12: 104,138,710 S382T probably benign Het
Serpinb9e T C 13: 33,255,116 F175S probably benign Het
Slc19a2 C T 1: 164,257,197 H219Y probably damaging Het
Slfn9 A T 11: 82,981,698 D737E possibly damaging Het
Snx31 T C 15: 36,539,298 E144G probably null Het
Sp2 A G 11: 96,963,456 probably benign Het
Spag9 C T 11: 94,116,837 L1117F probably damaging Het
Syndig1l A T 12: 84,680,363 probably benign Het
Sypl A T 12: 32,974,333 probably benign Het
Tmem169 T C 1: 72,300,696 M95T probably benign Het
Tmem206 T C 1: 191,328,289 probably benign Het
Tnfrsf17 A G 16: 11,315,202 Y48C possibly damaging Het
Ttn A T 2: 76,827,515 probably benign Het
Uap1 G C 1: 170,150,383 H366Q probably benign Het
Ulbp1 A G 10: 7,446,557 probably benign Het
Urb2 T C 8: 124,030,908 V1118A probably benign Het
Usp54 T C 14: 20,550,190 N1493S probably benign Het
Vmn1r129 C A 7: 21,360,730 V188F probably benign Het
Vmn1r226 A T 17: 20,687,732 L75F probably benign Het
Wdr78 T A 4: 103,087,418 L245F possibly damaging Het
Wisp1 T A 15: 66,919,271 N307K possibly damaging Het
Yes1 T A 5: 32,651,702 S137R probably benign Het
Zfp804b A G 5: 7,179,372 probably benign Het
Other mutations in Afap1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Afap1l2 APN 19 57002308 splice site probably benign
IGL01012:Afap1l2 APN 19 56930261 missense probably damaging 0.98
IGL01089:Afap1l2 APN 19 56913411 splice site probably null
IGL01150:Afap1l2 APN 19 56930186 missense probably damaging 0.99
IGL02393:Afap1l2 APN 19 56914440 missense probably damaging 1.00
IGL02887:Afap1l2 APN 19 56920563 missense probably damaging 1.00
IGL03060:Afap1l2 APN 19 56914250 nonsense probably null
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0282:Afap1l2 UTSW 19 56916221 missense possibly damaging 0.65
R0388:Afap1l2 UTSW 19 56917242 splice site probably benign
R0432:Afap1l2 UTSW 19 56917119 splice site probably benign
R0497:Afap1l2 UTSW 19 56930209 missense probably benign 0.27
R0578:Afap1l2 UTSW 19 56915782 missense probably benign 0.04
R0631:Afap1l2 UTSW 19 56916085 missense probably benign 0.39
R0670:Afap1l2 UTSW 19 56915803 missense probably damaging 1.00
R1188:Afap1l2 UTSW 19 56925069 missense probably damaging 0.97
R1236:Afap1l2 UTSW 19 56916472 missense possibly damaging 0.64
R1274:Afap1l2 UTSW 19 56914563 missense probably benign 0.02
R1497:Afap1l2 UTSW 19 56928311 missense probably benign 0.25
R1597:Afap1l2 UTSW 19 56914449 missense probably benign 0.14
R1778:Afap1l2 UTSW 19 56916206 missense possibly damaging 0.68
R1795:Afap1l2 UTSW 19 56928409 missense probably damaging 1.00
R1991:Afap1l2 UTSW 19 57002267 missense possibly damaging 0.62
R2113:Afap1l2 UTSW 19 56913389 missense possibly damaging 0.95
R2242:Afap1l2 UTSW 19 56914468 missense possibly damaging 0.56
R3429:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3430:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3698:Afap1l2 UTSW 19 56916523 missense possibly damaging 0.69
R4706:Afap1l2 UTSW 19 56937240 missense possibly damaging 0.76
R4956:Afap1l2 UTSW 19 56943447 missense probably benign 0.00
R4993:Afap1l2 UTSW 19 56918040 missense probably damaging 1.00
R5772:Afap1l2 UTSW 19 56922974 missense probably benign 0.02
R5878:Afap1l2 UTSW 19 56915675 missense probably benign 0.01
R6194:Afap1l2 UTSW 19 56922951 missense probably damaging 1.00
R6226:Afap1l2 UTSW 19 56916128 missense probably benign 0.00
R6334:Afap1l2 UTSW 19 56917976 unclassified probably null
R6439:Afap1l2 UTSW 19 56928386 missense possibly damaging 0.91
X0062:Afap1l2 UTSW 19 56918033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGACAGCAACTTTCCTGCTATG -3'
(R):5'- GTGCAGATAGATACTCATGCCCAGC -3'

Sequencing Primer
(F):5'- GCTAGGGAAATGTTAAACTCTCC -3'
(R):5'- TGGATCTTCCTTGCAGAGGA -3'
Posted On2014-03-14