Incidental Mutation 'R1433:Zfp335'
ID159292
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1433 (G1)
Quality Score173
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164899456 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 685 (H685R)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect probably damaging
Transcript: ENSMUST00000041361
AA Change: H685R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: H685R

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAGACAAGTGCTGGAAAGCTACCC -3'
(R):5'- AGGTGACCTTGAGAATGACCCCTG -3'

Sequencing Primer
(F):5'- TCTAACCAGGCTGGTGTCC -3'
(R):5'- ACAGCAGTGTTTGTCCAAGC -3'
Posted On2014-03-14