Incidental Mutation 'R1433:Adamts9'
ID159309
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms8430403M15Rik, E030027K14Rik, 1810011L16Rik
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1433 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92772699-92943492 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 92849290 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]
Predicted Effect probably null
Transcript: ENSMUST00000113438
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133858
Predicted Effect probably null
Transcript: ENSMUST00000167391
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203690
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92859902 missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92860174 missense probably benign 0.00
IGL01462:Adamts9 APN 6 92894266 missense probably benign 0.04
IGL01551:Adamts9 APN 6 92807020 missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92858147 splice site probably benign
IGL01638:Adamts9 APN 6 92872428 missense probably benign 0.19
IGL01757:Adamts9 APN 6 92796159 missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92777439 missense probably benign 0.00
IGL02379:Adamts9 APN 6 92797033 missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92796997 missense probably benign 0.04
IGL02554:Adamts9 APN 6 92880847 missense probably benign 0.01
IGL02832:Adamts9 APN 6 92807175 missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92889937 missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92887432 nonsense probably null
IGL03401:Adamts9 APN 6 92786868 missense probably damaging 0.97
Bluebeard UTSW 6 92879959 nonsense probably null
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0067:Adamts9 UTSW 6 92890167 missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92943085 missense probably benign
R0326:Adamts9 UTSW 6 92858057 nonsense probably null
R0396:Adamts9 UTSW 6 92798005 missense probably benign 0.00
R0490:Adamts9 UTSW 6 92872866 missense probably benign
R0504:Adamts9 UTSW 6 92912645 missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92858113 missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92880957 missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92903802 missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92796433 missense probably benign
R1558:Adamts9 UTSW 6 92908711 missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92880623 missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92863376 missense probably benign 0.27
R1855:Adamts9 UTSW 6 92901369 splice site probably benign
R1887:Adamts9 UTSW 6 92872788 critical splice donor site probably null
R1934:Adamts9 UTSW 6 92943121 missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92859849 missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92796394 missense probably benign
R2370:Adamts9 UTSW 6 92860203 missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92912831 missense probably benign
R2432:Adamts9 UTSW 6 92857900 missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92795910 splice site probably benign
R3015:Adamts9 UTSW 6 92872932 missense probably benign 0.05
R3611:Adamts9 UTSW 6 92869984 missense probably benign 0.05
R4024:Adamts9 UTSW 6 92872784 splice site probably benign
R4292:Adamts9 UTSW 6 92795996 missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92859864 missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92879959 nonsense probably null
R4677:Adamts9 UTSW 6 92816606 start codon destroyed probably null
R5114:Adamts9 UTSW 6 92890273 missense probably benign 0.03
R5260:Adamts9 UTSW 6 92807137 missense probably benign 0.00
R5384:Adamts9 UTSW 6 92798018 missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92880697 missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92854365 missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92798133 missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92903786 missense probably benign 0.02
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92859926 missense possibly damaging 0.83
R6051:Adamts9 UTSW 6 92890118 missense probably damaging 1.00
R6082:Adamts9 UTSW 6 92889949 missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92797021 missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92890120 missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92872335 missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92905191 missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92863354 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GTCTGGCCCTCAACAAGTAGGAAC -3'
(R):5'- CCTCTTCCAGTGTACCAAGCTGTG -3'

Sequencing Primer
(F):5'- TTGACAGTGCCATCCAGTG -3'
(R):5'- ACCAAGCTGTGTGGTGGAG -3'
Posted On2014-03-14