Incidental Mutation 'R1433:Xylt1'
ID159316
Institutional Source Beutler Lab
Gene Symbol Xylt1
Ensembl Gene ENSMUSG00000030657
Gene Namexylosyltransferase 1
Synonyms
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1433 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location117380979-117673580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117591952 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 325 (V325A)
Ref Sequence ENSEMBL: ENSMUSP00000032892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032892]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032892
AA Change: V325A

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032892
Gene: ENSMUSG00000030657
AA Change: V325A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 75 104 N/A INTRINSIC
Pfam:Branch 322 577 7.8e-53 PFAM
Pfam:Xylo_C 607 787 2.6e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160035
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a xylosyltransferase enzyme. The encoded protein catalyzes transfer of UDP-xylose to serine residues of an acceptor protein substrate. This transfer reaction is necessary for biosynthesis of glycosaminoglycan chains. Mutations in this gene have been associated with increased severity of pseudoxanthoma elasticum.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit partial preweaning lethality, impaired chondrocyte maturation and decreased skeletal length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Xylt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Xylt1 APN 7 117650685 missense probably damaging 0.99
IGL01306:Xylt1 APN 7 117548890 missense probably benign 0.00
IGL01656:Xylt1 APN 7 117548993 missense probably damaging 1.00
IGL02152:Xylt1 APN 7 117634770 missense probably damaging 1.00
IGL02188:Xylt1 APN 7 117634737 missense probably damaging 1.00
IGL02732:Xylt1 APN 7 117591937 missense possibly damaging 0.75
IGL02944:Xylt1 APN 7 117634757 missense probably benign 0.00
IGL03308:Xylt1 APN 7 117637751 nonsense probably null
IGL03393:Xylt1 APN 7 117593713 missense probably damaging 1.00
ANU23:Xylt1 UTSW 7 117548890 missense probably benign 0.00
PIT4378001:Xylt1 UTSW 7 117548865 missense possibly damaging 0.83
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0970:Xylt1 UTSW 7 117634736 missense probably damaging 0.96
R1762:Xylt1 UTSW 7 117637761 missense probably benign 0.00
R2169:Xylt1 UTSW 7 117667437 missense probably damaging 1.00
R2937:Xylt1 UTSW 7 117634784 missense probably benign 0.04
R3024:Xylt1 UTSW 7 117548648 missense probably damaging 1.00
R3855:Xylt1 UTSW 7 117593550 missense probably damaging 1.00
R4006:Xylt1 UTSW 7 117475513 missense probably benign 0.01
R4329:Xylt1 UTSW 7 117656461 missense probably damaging 1.00
R4794:Xylt1 UTSW 7 117637635 missense probably benign 0.07
R4975:Xylt1 UTSW 7 117667342 missense probably damaging 1.00
R5225:Xylt1 UTSW 7 117592036 missense probably damaging 1.00
R5679:Xylt1 UTSW 7 117643650 missense probably damaging 1.00
R5707:Xylt1 UTSW 7 117656494 missense possibly damaging 0.95
R5756:Xylt1 UTSW 7 117650700 missense probably damaging 0.97
R5802:Xylt1 UTSW 7 117656691 missense probably benign 0.43
R6057:Xylt1 UTSW 7 117591908 missense probably benign 0.02
R6249:Xylt1 UTSW 7 117667305 missense probably benign 0.11
R6298:Xylt1 UTSW 7 117656737 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGACCGTTCGTACTTTCTAAAGGGCA -3'
(R):5'- ACTATCAGCAATGCAGAACATGGTGT -3'

Sequencing Primer
(F):5'- GTACTTTCTAAAGGGCAGACCATC -3'
(R):5'- acacacacaaacacacacac -3'
Posted On2014-03-14