Incidental Mutation 'R1433:Slc28a3'
ID159335
Institutional Source Beutler Lab
Gene Symbol Slc28a3
Ensembl Gene ENSMUSG00000021553
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 3
SynonymsCnt3
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1433 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location58545399-58610877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58563106 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 534 (E534G)
Ref Sequence ENSEMBL: ENSMUSP00000022036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022036] [ENSMUST00000140760]
Predicted Effect probably damaging
Transcript: ENSMUST00000022036
AA Change: E534G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022036
Gene: ENSMUSG00000021553
AA Change: E534G

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 146 163 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Pfam:Nucleos_tra2_N 221 292 3.5e-27 PFAM
Pfam:Gate 300 401 4.9e-11 PFAM
Pfam:Nucleos_tra2_C 403 627 4.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140760
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoside transporters, such as SLC28A3, regulate multiple cellular processes, including neurotransmission, vascular tone, adenosine concentration in the vicinity of cell surface receptors, and transport and metabolism of nucleoside drugs. SLC28A3 shows broad specificity for pyrimidine and purine nucleosides (Ritzel et al., 2001 [PubMed 11032837]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Apol7b A G 15: 77,425,546 L17P probably damaging Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Slc28a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc28a3 APN 13 58574300 missense probably benign 0.05
IGL00432:Slc28a3 APN 13 58569411 splice site probably null
IGL00553:Slc28a3 APN 13 58563009 splice site probably null
IGL01725:Slc28a3 APN 13 58578510 missense probably benign 0.30
IGL02068:Slc28a3 APN 13 58558597 missense probably damaging 1.00
IGL02270:Slc28a3 APN 13 58580584 missense probably benign 0.00
IGL02271:Slc28a3 APN 13 58558637 missense probably benign 0.21
IGL02373:Slc28a3 APN 13 58578404 critical splice donor site probably null
IGL02542:Slc28a3 APN 13 58573470 missense probably damaging 1.00
IGL03242:Slc28a3 APN 13 58574249 nonsense probably null
R0256:Slc28a3 UTSW 13 58573500 missense probably benign
R0323:Slc28a3 UTSW 13 58564052 nonsense probably null
R0391:Slc28a3 UTSW 13 58569415 splice site probably benign
R0838:Slc28a3 UTSW 13 58588269 missense probably benign 0.00
R1437:Slc28a3 UTSW 13 58558575 nonsense probably null
R3499:Slc28a3 UTSW 13 58573439 splice site probably benign
R3822:Slc28a3 UTSW 13 58558278 missense probably benign 0.00
R3948:Slc28a3 UTSW 13 58563010 splice site probably null
R4011:Slc28a3 UTSW 13 58566250 missense probably benign 0.06
R4028:Slc28a3 UTSW 13 58610756 missense probably benign 0.27
R4073:Slc28a3 UTSW 13 58559290 missense probably benign 0.01
R4745:Slc28a3 UTSW 13 58574263 missense possibly damaging 0.69
R4939:Slc28a3 UTSW 13 58558581 missense probably benign 0.44
R5416:Slc28a3 UTSW 13 58576793 missense probably damaging 0.99
R5421:Slc28a3 UTSW 13 58574265 missense possibly damaging 0.87
R5426:Slc28a3 UTSW 13 58563154 missense probably damaging 1.00
R5688:Slc28a3 UTSW 13 58558649 missense probably damaging 0.96
R6066:Slc28a3 UTSW 13 58578487 missense probably benign 0.00
R6790:Slc28a3 UTSW 13 58582650 missense probably benign 0.00
R6919:Slc28a3 UTSW 13 58573443 critical splice donor site probably null
R7009:Slc28a3 UTSW 13 58610804 missense probably benign 0.28
R7102:Slc28a3 UTSW 13 58588214 missense probably benign 0.04
R7305:Slc28a3 UTSW 13 58566231 missense possibly damaging 0.65
R7307:Slc28a3 UTSW 13 58563172 missense probably damaging 1.00
R7464:Slc28a3 UTSW 13 58563021 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCACTCAAGTTCCAGACAGTCAGAAG -3'
(R):5'- GGTGTGGCAGAATTCGAGGCAATC -3'

Sequencing Primer
(F):5'- GCTGCATCTAAGTCACAGTGTATC -3'
(R):5'- CGAGGCAATCACTGTTTAATGAG -3'
Posted On2014-03-14