Incidental Mutation 'R1433:Apol7b'
ID159339
Institutional Source Beutler Lab
Gene Symbol Apol7b
Ensembl Gene ENSMUSG00000068252
Gene Nameapolipoprotein L 7b
Synonyms
MMRRC Submission 039488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1433 (G1)
Quality Score156
Status Not validated
Chromosome15
Chromosomal Location77422209-77447492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77425546 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 17 (L17P)
Ref Sequence ENSEMBL: ENSMUSP00000154906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089469] [ENSMUST00000229434]
Predicted Effect probably damaging
Transcript: ENSMUST00000089469
AA Change: L17P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086894
Gene: ENSMUSG00000068252
AA Change: L17P

DomainStartEndE-ValueType
Pfam:ApoL 20 82 7.9e-15 PFAM
Pfam:ApoL 77 367 1.9e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229381
Predicted Effect probably damaging
Transcript: ENSMUST00000229434
AA Change: L17P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A T 6: 116,652,262 S189C possibly damaging Het
Acp1 C T 12: 30,895,935 E140K possibly damaging Het
Acsm4 T A 7: 119,693,819 D57E probably damaging Het
Adamts9 A G 6: 92,849,290 probably null Het
Aen T A 7: 78,907,312 Y303N probably damaging Het
Alcam T C 16: 52,295,752 probably null Het
Cacna1c A T 6: 118,652,793 Y1058* probably null Het
Camk2d T C 3: 126,808,224 V354A probably benign Het
Carf T G 1: 60,124,858 M43R probably damaging Het
Casp8 T A 1: 58,824,124 F81Y probably damaging Het
Cd74 G A 18: 60,803,992 R20H probably benign Het
Cers5 A T 15: 99,745,931 Y16* probably null Het
Chuk A T 19: 44,078,958 M586K probably null Het
D130043K22Rik C A 13: 24,871,341 P496Q probably damaging Het
Dab2 A G 15: 6,429,938 R311G probably damaging Het
Diaph1 A T 18: 37,905,134 I48N unknown Het
Dnajc13 T C 9: 104,180,121 D1560G probably damaging Het
Dsg2 T C 18: 20,582,723 S241P probably damaging Het
Efcab5 T C 11: 77,105,378 D1119G probably benign Het
Efr3a G T 15: 65,869,057 probably benign Het
Evc2 A G 5: 37,393,083 K814E probably damaging Het
Gm5724 A G 6: 141,765,703 M94T probably benign Het
Hic2 A G 16: 17,258,822 D505G probably benign Het
Ing1 T A 8: 11,557,010 V34D probably damaging Het
Inpp5k A G 11: 75,637,491 M172V probably benign Het
Itgae T C 11: 73,115,592 V362A probably damaging Het
Lama2 T A 10: 27,187,754 R1346S probably damaging Het
Lrrc7 T C 3: 158,177,306 N450S probably damaging Het
Lrrn3 T A 12: 41,452,584 Y578F possibly damaging Het
Maml2 A T 9: 13,706,501 N381I probably damaging Het
Mettl15 T G 2: 109,092,921 E385D probably benign Het
Mthfr T A 4: 148,055,443 I623N possibly damaging Het
Muc4 A C 16: 32,753,020 N966T probably benign Het
Myoc A G 1: 162,648,996 Y423C probably damaging Het
Ncoa2 A T 1: 13,148,378 M1409K probably benign Het
Ncor2 T C 5: 125,109,975 probably benign Het
Numb T C 12: 83,797,259 E395G probably damaging Het
Oas1g A G 5: 120,881,949 F198S probably damaging Het
Olfr1367 T C 13: 21,347,024 V32A probably benign Het
Olfr181 A G 16: 58,925,686 V295A probably benign Het
Prdm13 T A 4: 21,678,909 Y527F probably damaging Het
Prr14l A G 5: 32,828,833 L1106P probably damaging Het
Ptbp1 T A 10: 79,863,273 I555N probably damaging Het
Ptchd4 A T 17: 42,503,715 T836S possibly damaging Het
Rlbp1 T C 7: 79,383,938 D3G probably benign Het
Sdk2 T C 11: 113,795,045 E1883G probably damaging Het
Serpinc1 A T 1: 160,993,404 K140N probably damaging Het
Serpind1 A T 16: 17,342,385 Y382F probably damaging Het
Slc28a3 T C 13: 58,563,106 E534G probably damaging Het
Ttyh2 T A 11: 114,710,179 I418N probably benign Het
Tubgcp4 C T 2: 121,175,424 Q98* probably null Het
Ugt2a2 A G 5: 87,464,106 L315P probably damaging Het
Vwa1 A T 4: 155,772,901 S147T probably damaging Het
Xylt1 T C 7: 117,591,952 V325A possibly damaging Het
Zfp335 T C 2: 164,899,456 H685R probably damaging Het
Other mutations in Apol7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Apol7b APN 15 77423914 missense probably damaging 1.00
IGL02081:Apol7b APN 15 77423536 missense possibly damaging 0.83
IGL02350:Apol7b APN 15 77423632 missense probably benign 0.05
IGL02357:Apol7b APN 15 77423632 missense probably benign 0.05
R0506:Apol7b UTSW 15 77425528 missense probably benign 0.02
R1187:Apol7b UTSW 15 77423403 missense possibly damaging 0.94
R1978:Apol7b UTSW 15 77423339 missense probably damaging 0.99
R2272:Apol7b UTSW 15 77423710 missense probably damaging 1.00
R4012:Apol7b UTSW 15 77424709 missense probably damaging 0.98
R4485:Apol7b UTSW 15 77423666 missense probably benign
R4571:Apol7b UTSW 15 77423534 missense probably benign 0.01
R4823:Apol7b UTSW 15 77427782 utr 5 prime probably benign
R5018:Apol7b UTSW 15 77424716 missense probably benign 0.03
R5944:Apol7b UTSW 15 77423767 missense probably damaging 0.99
R6514:Apol7b UTSW 15 77423926 missense probably benign 0.00
R6519:Apol7b UTSW 15 77423348 missense probably benign 0.01
R6808:Apol7b UTSW 15 77424673 missense probably damaging 1.00
R6904:Apol7b UTSW 15 77423425 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGGAATAGTTTTGCTCCCTGTGGC -3'
(R):5'- GCTCTGGACTCTGACACTCACAAC -3'

Sequencing Primer
(F):5'- TATTTGCTGAGAAGAGACACCCTC -3'
(R):5'- caggaaaagagaaaacagacagg -3'
Posted On2014-03-14