Incidental Mutation 'R1434:Ctnnal1'
ID159369
Institutional Source Beutler Lab
Gene Symbol Ctnnal1
Ensembl Gene ENSMUSG00000038816
Gene Namecatenin (cadherin associated protein), alpha-like 1
SynonymsCatnal1, ACRP
MMRRC Submission 039489-MU
Accession Numbers

Genbank: NM_018761.3; Ensembl: ENSMUST00000045142, ENSMUST00000107612

Is this an essential gene? Possibly non essential (E-score: 0.276) question?
Stock #R1434 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location56810935-56865188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56847971 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 56 (N56I)
Ref Sequence ENSEMBL: ENSMUSP00000103237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045142] [ENSMUST00000107612]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045142
AA Change: N56I

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000036487
Gene: ENSMUSG00000038816
AA Change: N56I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:Vinculin 30 309 7e-39 PFAM
Pfam:Vinculin 302 526 1.7e-12 PFAM
Pfam:Vinculin 531 683 5.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107612
AA Change: N56I

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103237
Gene: ENSMUSG00000038816
AA Change: N56I

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:Vinculin 30 214 5.4e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132764
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134754
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and fertile and exhibit no overt phenotypes or defects in hematopoiesis and hematopoietic stem cell function. [provided by MGI curators]
Allele List at MGI

All alleles(111) : Targeted, other(2) Gene trapped(109)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,639 probably benign Het
Abca12 G T 1: 71,309,800 H851N probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Ankhd1 A G 18: 36,625,159 I969V probably benign Het
Apob A G 12: 8,009,715 I2699M probably damaging Het
Aqr A T 2: 114,150,409 L297Q probably damaging Het
BC067074 G A 13: 113,368,492 V510I possibly damaging Het
Camsap1 A G 2: 25,945,178 Y301H probably damaging Het
Ccdc88c A G 12: 100,939,166 probably benign Het
Cd209b T A 8: 3,923,367 I106F possibly damaging Het
Cdkn1b T A 6: 134,921,097 W60R probably damaging Het
Coasy A G 11: 101,084,996 probably benign Het
Col2a1 T A 15: 97,979,651 Q1017L probably damaging Het
Cyb561d2 T A 9: 107,541,643 probably benign Het
Dcst1 G T 3: 89,352,519 T632N probably damaging Het
Ddx1 C T 12: 13,237,231 V267I probably benign Het
Dnah10 A T 5: 124,774,986 M1736L probably benign Het
Eln G A 5: 134,729,437 probably benign Het
Enpp2 A T 15: 54,862,681 D566E probably damaging Het
Ezh1 T C 11: 101,194,917 K638R probably damaging Het
Fam172a A T 13: 77,761,922 Y98F probably damaging Het
Fdx1l C A 9: 21,073,398 G37W probably benign Het
Grin2b T C 6: 135,843,195 I340V probably benign Het
Ikbkap T A 4: 56,781,193 E493D probably benign Het
Il16 T C 7: 83,655,312 T671A probably benign Het
Kcnd2 T A 6: 21,216,357 M20K probably damaging Het
Kndc1 C T 7: 139,922,684 S962F probably damaging Het
L1td1 A G 4: 98,737,817 S750G possibly damaging Het
Lama2 A G 10: 27,208,370 C935R probably damaging Het
Lgalsl T C 11: 20,826,418 D158G possibly damaging Het
Lman1 A T 18: 65,993,073 probably null Het
Lmtk2 A G 5: 144,174,589 E709G probably damaging Het
Lrfn3 T C 7: 30,355,927 H531R possibly damaging Het
Mark3 A G 12: 111,623,325 probably benign Het
Mov10 T C 3: 104,795,174 E997G probably damaging Het
Myo15 T A 11: 60,504,331 W2484R probably benign Het
Myo1g G T 11: 6,509,372 Q833K probably benign Het
Ncoa3 T A 2: 166,055,510 D740E probably benign Het
Nol12 A G 15: 78,937,953 probably benign Het
Nrxn2 T A 19: 6,443,612 probably null Het
Nsfl1c A C 2: 151,500,746 I79L probably benign Het
Olfr1462 A G 19: 13,191,298 I210M probably benign Het
Olfr173 G T 16: 58,797,448 H133N probably benign Het
Olfr691 T C 7: 105,337,261 I152V probably benign Het
Osbpl8 A C 10: 111,291,581 E842A probably benign Het
Pdxk G T 10: 78,440,811 T310K probably benign Het
Phip T G 9: 82,959,605 K54Q probably damaging Het
Pklr A T 3: 89,143,035 D366V probably damaging Het
Plxna2 T A 1: 194,751,540 probably benign Het
Ppp4r3a A T 12: 101,043,524 V618E probably damaging Het
Prdm12 A T 2: 31,640,307 Q70L possibly damaging Het
Ptpn21 A T 12: 98,688,590 M706K probably damaging Het
Ptprq A T 10: 107,586,714 F1606I probably damaging Het
Rasgrp4 T C 7: 29,137,727 probably null Het
Rlbp1 C A 7: 79,379,913 probably null Het
Rtp2 T C 16: 23,927,443 D166G probably benign Het
Ryr3 A C 2: 112,645,259 F4481V probably damaging Het
Scn2a A G 2: 65,701,991 D649G possibly damaging Het
Slc30a5 T A 13: 100,803,442 D655V probably damaging Het
Slco5a1 G A 1: 12,871,908 A838V probably benign Het
Srprb A G 9: 103,190,302 V239A probably damaging Het
Tceanc2 T C 4: 107,147,640 T104A probably benign Het
Tcp1 T C 17: 12,922,606 probably null Het
Unc13b C T 4: 43,239,385 R1056* probably null Het
Wdr19 G A 5: 65,223,504 probably benign Het
Zadh2 A G 18: 84,094,471 K91E probably benign Het
Zfhx4 T A 3: 5,241,859 H48Q probably benign Het
Zfp787 T A 7: 6,132,235 H339L probably damaging Het
Zfp839 G T 12: 110,860,899 R408L probably benign Het
Other mutations in Ctnnal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Ctnnal1 APN 4 56829544 missense possibly damaging 0.90
IGL01404:Ctnnal1 APN 4 56829590 missense probably damaging 1.00
IGL01523:Ctnnal1 APN 4 56835243 missense probably damaging 1.00
IGL02413:Ctnnal1 APN 4 56835306 missense probably benign 0.19
IGL02618:Ctnnal1 APN 4 56817060 missense probably benign 0.07
IGL03109:Ctnnal1 APN 4 56839045 missense probably damaging 1.00
IGL03159:Ctnnal1 APN 4 56844599 missense probably benign 0.00
IGL03208:Ctnnal1 APN 4 56813833 missense probably benign 0.00
IGL03250:Ctnnal1 APN 4 56812356 missense probably benign 0.00
NA:Ctnnal1 UTSW 4 56817044 missense probably benign 0.02
R0217:Ctnnal1 UTSW 4 56813230 missense probably benign 0.43
R0391:Ctnnal1 UTSW 4 56847921 missense probably damaging 1.00
R0513:Ctnnal1 UTSW 4 56835348 missense probably benign 0.01
R0582:Ctnnal1 UTSW 4 56813228 missense probably damaging 1.00
R1638:Ctnnal1 UTSW 4 56813856 missense probably benign 0.06
R1760:Ctnnal1 UTSW 4 56838988 missense probably damaging 1.00
R1871:Ctnnal1 UTSW 4 56812534 missense probably benign 0.06
R1954:Ctnnal1 UTSW 4 56817242 splice site probably benign
R2050:Ctnnal1 UTSW 4 56835350 missense probably benign 0.38
R2104:Ctnnal1 UTSW 4 56812329 makesense probably null
R3104:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3106:Ctnnal1 UTSW 4 56813246 missense probably benign 0.11
R3918:Ctnnal1 UTSW 4 56865000 missense possibly damaging 0.89
R4705:Ctnnal1 UTSW 4 56812579 missense probably benign 0.09
R4757:Ctnnal1 UTSW 4 56847980 missense probably damaging 1.00
R4780:Ctnnal1 UTSW 4 56847857 missense probably damaging 1.00
R4988:Ctnnal1 UTSW 4 56847854 nonsense probably null
R5771:Ctnnal1 UTSW 4 56826328 missense probably benign 0.00
R5974:Ctnnal1 UTSW 4 56817067 missense probably damaging 1.00
R6061:Ctnnal1 UTSW 4 56812349 missense probably benign
R6129:Ctnnal1 UTSW 4 56829573 missense possibly damaging 0.93
R6389:Ctnnal1 UTSW 4 56813849 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACCAAAAGGAAGTTCCAGGTCAG -3'
(R):5'- TGGGAAATGATGCAAGATGCTCTGC -3'

Sequencing Primer
(F):5'- aacaaacaaacaaacaaacaaacac -3'
(R):5'- CTGGCCTGCAAGGTCTAAG -3'
Posted On2014-03-14