Incidental Mutation 'R1434:Kcnd2'
ID159376
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Namepotassium voltage-gated channel, Shal-related family, member 2
SynonymsKv4.2
MMRRC Submission 039489-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R1434 (G1)
Quality Score110
Status Validated
Chromosome6
Chromosomal Location21215503-21729805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21216357 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 20 (M20K)
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
Predicted Effect probably damaging
Transcript: ENSMUST00000081542
AA Change: M20K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882
AA Change: M20K

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,639 probably benign Het
Abca12 G T 1: 71,309,800 H851N probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Ankhd1 A G 18: 36,625,159 I969V probably benign Het
Apob A G 12: 8,009,715 I2699M probably damaging Het
Aqr A T 2: 114,150,409 L297Q probably damaging Het
BC067074 G A 13: 113,368,492 V510I possibly damaging Het
Camsap1 A G 2: 25,945,178 Y301H probably damaging Het
Ccdc88c A G 12: 100,939,166 probably benign Het
Cd209b T A 8: 3,923,367 I106F possibly damaging Het
Cdkn1b T A 6: 134,921,097 W60R probably damaging Het
Coasy A G 11: 101,084,996 probably benign Het
Col2a1 T A 15: 97,979,651 Q1017L probably damaging Het
Ctnnal1 T A 4: 56,847,971 N56I probably damaging Het
Cyb561d2 T A 9: 107,541,643 probably benign Het
Dcst1 G T 3: 89,352,519 T632N probably damaging Het
Ddx1 C T 12: 13,237,231 V267I probably benign Het
Dnah10 A T 5: 124,774,986 M1736L probably benign Het
Eln G A 5: 134,729,437 probably benign Het
Enpp2 A T 15: 54,862,681 D566E probably damaging Het
Ezh1 T C 11: 101,194,917 K638R probably damaging Het
Fam172a A T 13: 77,761,922 Y98F probably damaging Het
Fdx1l C A 9: 21,073,398 G37W probably benign Het
Grin2b T C 6: 135,843,195 I340V probably benign Het
Ikbkap T A 4: 56,781,193 E493D probably benign Het
Il16 T C 7: 83,655,312 T671A probably benign Het
Kndc1 C T 7: 139,922,684 S962F probably damaging Het
L1td1 A G 4: 98,737,817 S750G possibly damaging Het
Lama2 A G 10: 27,208,370 C935R probably damaging Het
Lgalsl T C 11: 20,826,418 D158G possibly damaging Het
Lman1 A T 18: 65,993,073 probably null Het
Lmtk2 A G 5: 144,174,589 E709G probably damaging Het
Lrfn3 T C 7: 30,355,927 H531R possibly damaging Het
Mark3 A G 12: 111,623,325 probably benign Het
Mov10 T C 3: 104,795,174 E997G probably damaging Het
Myo15 T A 11: 60,504,331 W2484R probably benign Het
Myo1g G T 11: 6,509,372 Q833K probably benign Het
Ncoa3 T A 2: 166,055,510 D740E probably benign Het
Nol12 A G 15: 78,937,953 probably benign Het
Nrxn2 T A 19: 6,443,612 probably null Het
Nsfl1c A C 2: 151,500,746 I79L probably benign Het
Olfr1462 A G 19: 13,191,298 I210M probably benign Het
Olfr173 G T 16: 58,797,448 H133N probably benign Het
Olfr691 T C 7: 105,337,261 I152V probably benign Het
Osbpl8 A C 10: 111,291,581 E842A probably benign Het
Pdxk G T 10: 78,440,811 T310K probably benign Het
Phip T G 9: 82,959,605 K54Q probably damaging Het
Pklr A T 3: 89,143,035 D366V probably damaging Het
Plxna2 T A 1: 194,751,540 probably benign Het
Ppp4r3a A T 12: 101,043,524 V618E probably damaging Het
Prdm12 A T 2: 31,640,307 Q70L possibly damaging Het
Ptpn21 A T 12: 98,688,590 M706K probably damaging Het
Ptprq A T 10: 107,586,714 F1606I probably damaging Het
Rasgrp4 T C 7: 29,137,727 probably null Het
Rlbp1 C A 7: 79,379,913 probably null Het
Rtp2 T C 16: 23,927,443 D166G probably benign Het
Ryr3 A C 2: 112,645,259 F4481V probably damaging Het
Scn2a A G 2: 65,701,991 D649G possibly damaging Het
Slc30a5 T A 13: 100,803,442 D655V probably damaging Het
Slco5a1 G A 1: 12,871,908 A838V probably benign Het
Srprb A G 9: 103,190,302 V239A probably damaging Het
Tceanc2 T C 4: 107,147,640 T104A probably benign Het
Tcp1 T C 17: 12,922,606 probably null Het
Unc13b C T 4: 43,239,385 R1056* probably null Het
Wdr19 G A 5: 65,223,504 probably benign Het
Zadh2 A G 18: 84,094,471 K91E probably benign Het
Zfhx4 T A 3: 5,241,859 H48Q probably benign Het
Zfp787 T A 7: 6,132,235 H339L probably damaging Het
Zfp839 G T 12: 110,860,899 R408L probably benign Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21714154 missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21217217 missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21727340 makesense probably null
IGL01534:Kcnd2 APN 6 21726145 missense probably benign
IGL02623:Kcnd2 APN 6 21726195 missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21216925 nonsense probably null
IGL02874:Kcnd2 APN 6 21216923 missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21217149 missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21216555 missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21216509 nonsense probably null
IGL03154:Kcnd2 APN 6 21216708 missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21216516 missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21714209 missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21216683 missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21216442 missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21726239 splice site probably benign
R0836:Kcnd2 UTSW 6 21727329 missense probably damaging 1.00
R0884:Kcnd2 UTSW 6 21216541 missense probably benign
R2116:Kcnd2 UTSW 6 21216432 missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21217263 nonsense probably null
R3939:Kcnd2 UTSW 6 21217096 missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21216897 missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21216396 missense probably benign
R4707:Kcnd2 UTSW 6 21723212 missense probably benign
R5523:Kcnd2 UTSW 6 21723212 missense probably benign
R5545:Kcnd2 UTSW 6 21217019 missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21217085 missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21216588 missense probably damaging 1.00
X0021:Kcnd2 UTSW 6 21217323 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCGTGTTCCTGTGAGCAGTGTCC -3'
(R):5'- GGCCAAAGAAGGCCAGTTCTTCATC -3'

Sequencing Primer
(F):5'- AGTGTCCCCCCAGTGTTTTG -3'
(R):5'- GTTCTTCATCATAAGCCGAGATGC -3'
Posted On2014-03-14