Incidental Mutation 'R1434:Cdkn1b'
ID159377
Institutional Source Beutler Lab
Gene Symbol Cdkn1b
Ensembl Gene ENSMUSG00000003031
Gene Namecyclin-dependent kinase inhibitor 1B
Synonymsp27Kip1, p27
MMRRC Submission 039489-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.815) question?
Stock #R1434 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location134920401-134925513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134921097 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 60 (W60R)
Ref Sequence ENSEMBL: ENSMUSP00000145056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003115] [ENSMUST00000067327] [ENSMUST00000204807]
Predicted Effect probably damaging
Transcript: ENSMUST00000003115
AA Change: W60R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003115
Gene: ENSMUSG00000003031
AA Change: W60R

DomainStartEndE-ValueType
Pfam:CDI 30 80 8.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000067327
AA Change: W60R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065832
Gene: ENSMUSG00000003031
AA Change: W60R

DomainStartEndE-ValueType
Pfam:CDI 31 79 7.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204807
AA Change: W60R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145056
Gene: ENSMUSG00000003031
AA Change: W60R

DomainStartEndE-ValueType
Pfam:CDI 31 79 7.6e-25 PFAM
Meta Mutation Damage Score 0.67 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cyclin-dependent kinase inhibitor, which shares a limited similarity with CDK inhibitor CDKN1A/p21. The encoded protein binds to and prevents the activation of cyclin E-CDK2 or cyclin D-CDK4 complexes, and thus controls the cell cycle progression at G1. The degradation of this protein, which is triggered by its CDK dependent phosphorylation and subsequent ubiquitination by SCF complexes, is required for the cellular transition from quiescence to the proliferative state. Mutations in this gene are associated with multiple endocrine neoplasia type IV (MEN4). [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mutants have increased body weight, enlargement of major organs, impaired hearing and increased tumor susceptibility. Females are sterile, having impaired luteal cell differentiation and disrupted estrus cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,639 probably benign Het
Abca12 G T 1: 71,309,800 H851N probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Ankhd1 A G 18: 36,625,159 I969V probably benign Het
Apob A G 12: 8,009,715 I2699M probably damaging Het
Aqr A T 2: 114,150,409 L297Q probably damaging Het
BC067074 G A 13: 113,368,492 V510I possibly damaging Het
Camsap1 A G 2: 25,945,178 Y301H probably damaging Het
Ccdc88c A G 12: 100,939,166 probably benign Het
Cd209b T A 8: 3,923,367 I106F possibly damaging Het
Coasy A G 11: 101,084,996 probably benign Het
Col2a1 T A 15: 97,979,651 Q1017L probably damaging Het
Ctnnal1 T A 4: 56,847,971 N56I probably damaging Het
Cyb561d2 T A 9: 107,541,643 probably benign Het
Dcst1 G T 3: 89,352,519 T632N probably damaging Het
Ddx1 C T 12: 13,237,231 V267I probably benign Het
Dnah10 A T 5: 124,774,986 M1736L probably benign Het
Eln G A 5: 134,729,437 probably benign Het
Enpp2 A T 15: 54,862,681 D566E probably damaging Het
Ezh1 T C 11: 101,194,917 K638R probably damaging Het
Fam172a A T 13: 77,761,922 Y98F probably damaging Het
Fdx1l C A 9: 21,073,398 G37W probably benign Het
Grin2b T C 6: 135,843,195 I340V probably benign Het
Ikbkap T A 4: 56,781,193 E493D probably benign Het
Il16 T C 7: 83,655,312 T671A probably benign Het
Kcnd2 T A 6: 21,216,357 M20K probably damaging Het
Kndc1 C T 7: 139,922,684 S962F probably damaging Het
L1td1 A G 4: 98,737,817 S750G possibly damaging Het
Lama2 A G 10: 27,208,370 C935R probably damaging Het
Lgalsl T C 11: 20,826,418 D158G possibly damaging Het
Lman1 A T 18: 65,993,073 probably null Het
Lmtk2 A G 5: 144,174,589 E709G probably damaging Het
Lrfn3 T C 7: 30,355,927 H531R possibly damaging Het
Mark3 A G 12: 111,623,325 probably benign Het
Mov10 T C 3: 104,795,174 E997G probably damaging Het
Myo15 T A 11: 60,504,331 W2484R probably benign Het
Myo1g G T 11: 6,509,372 Q833K probably benign Het
Ncoa3 T A 2: 166,055,510 D740E probably benign Het
Nol12 A G 15: 78,937,953 probably benign Het
Nrxn2 T A 19: 6,443,612 probably null Het
Nsfl1c A C 2: 151,500,746 I79L probably benign Het
Olfr1462 A G 19: 13,191,298 I210M probably benign Het
Olfr173 G T 16: 58,797,448 H133N probably benign Het
Olfr691 T C 7: 105,337,261 I152V probably benign Het
Osbpl8 A C 10: 111,291,581 E842A probably benign Het
Pdxk G T 10: 78,440,811 T310K probably benign Het
Phip T G 9: 82,959,605 K54Q probably damaging Het
Pklr A T 3: 89,143,035 D366V probably damaging Het
Plxna2 T A 1: 194,751,540 probably benign Het
Ppp4r3a A T 12: 101,043,524 V618E probably damaging Het
Prdm12 A T 2: 31,640,307 Q70L possibly damaging Het
Ptpn21 A T 12: 98,688,590 M706K probably damaging Het
Ptprq A T 10: 107,586,714 F1606I probably damaging Het
Rasgrp4 T C 7: 29,137,727 probably null Het
Rlbp1 C A 7: 79,379,913 probably null Het
Rtp2 T C 16: 23,927,443 D166G probably benign Het
Ryr3 A C 2: 112,645,259 F4481V probably damaging Het
Scn2a A G 2: 65,701,991 D649G possibly damaging Het
Slc30a5 T A 13: 100,803,442 D655V probably damaging Het
Slco5a1 G A 1: 12,871,908 A838V probably benign Het
Srprb A G 9: 103,190,302 V239A probably damaging Het
Tceanc2 T C 4: 107,147,640 T104A probably benign Het
Tcp1 T C 17: 12,922,606 probably null Het
Unc13b C T 4: 43,239,385 R1056* probably null Het
Wdr19 G A 5: 65,223,504 probably benign Het
Zadh2 A G 18: 84,094,471 K91E probably benign Het
Zfhx4 T A 3: 5,241,859 H48Q probably benign Het
Zfp787 T A 7: 6,132,235 H339L probably damaging Het
Zfp839 G T 12: 110,860,899 R408L probably benign Het
Other mutations in Cdkn1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Cdkn1b APN 6 134921007 nonsense probably null
R2005:Cdkn1b UTSW 6 134921956 small insertion probably benign
R6213:Cdkn1b UTSW 6 134921243 missense probably benign 0.03
R6518:Cdkn1b UTSW 6 134921320 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCGAAGAGGGTTTTGCGCTCCATC -3'
(R):5'- AAATGCCGGTCCTCAGAGTTTGC -3'

Sequencing Primer
(F):5'- CCATCCGTGGCGTTTCG -3'
(R):5'- GTTTGCCTGAGACCCAATTAAAGG -3'
Posted On2014-03-14