Incidental Mutation 'R1434:Srprb'
ID159388
Institutional Source Beutler Lab
Gene Symbol Srprb
Ensembl Gene ENSMUSG00000032553
Gene Namesignal recognition particle receptor, B subunit
Synonyms
MMRRC Submission 039489-MU
Accession Numbers

Genbank: NM_009275.4; Ensembl: ENSMUST00000035157

Is this an essential gene? Probably essential (E-score: 0.802) question?
Stock #R1434 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103188032-103202137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103190302 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 239 (V239A)
Ref Sequence ENSEMBL: ENSMUSP00000035157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035157] [ENSMUST00000166836] [ENSMUST00000190760]
PDB Structure
The Structure of the Mammalian SRP Receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000035157
AA Change: V239A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035157
Gene: ENSMUSG00000032553
AA Change: V239A

DomainStartEndE-ValueType
Pfam:Arf 49 221 1.1e-17 PFAM
Pfam:SRPRB 60 239 1.2e-75 PFAM
Pfam:FeoB_N 63 214 7e-7 PFAM
Pfam:MMR_HSR1 64 179 3.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163567
Predicted Effect probably benign
Transcript: ENSMUST00000166836
AA Change: V948A

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127808
Gene: ENSMUSG00000090639
AA Change: V948A

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
TR_FER 25 338 4.98e-175 SMART
TR_FER 346 672 8.64e-193 SMART
Pfam:Arf 758 928 1.5e-15 PFAM
Pfam:SRPRB 769 948 1.4e-73 PFAM
Pfam:MMR_HSR1 773 888 7.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190760
Meta Mutation Damage Score 0.256 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to mouse protein which is a subunit of the signal recognition particle receptor (SR). This subunit is a transmembrane GTPase belonging to the GTPase superfamily. It anchors alpha subunit, a peripheral membrane GTPase, to the ER membrane. SR is required for the cotranslational targeting of both secretory and membrane proteins to the ER membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,639 probably benign Het
Abca12 G T 1: 71,309,800 H851N probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Ankhd1 A G 18: 36,625,159 I969V probably benign Het
Apob A G 12: 8,009,715 I2699M probably damaging Het
Aqr A T 2: 114,150,409 L297Q probably damaging Het
BC067074 G A 13: 113,368,492 V510I possibly damaging Het
Camsap1 A G 2: 25,945,178 Y301H probably damaging Het
Ccdc88c A G 12: 100,939,166 probably benign Het
Cd209b T A 8: 3,923,367 I106F possibly damaging Het
Cdkn1b T A 6: 134,921,097 W60R probably damaging Het
Coasy A G 11: 101,084,996 probably benign Het
Col2a1 T A 15: 97,979,651 Q1017L probably damaging Het
Ctnnal1 T A 4: 56,847,971 N56I probably damaging Het
Cyb561d2 T A 9: 107,541,643 probably benign Het
Dcst1 G T 3: 89,352,519 T632N probably damaging Het
Ddx1 C T 12: 13,237,231 V267I probably benign Het
Dnah10 A T 5: 124,774,986 M1736L probably benign Het
Eln G A 5: 134,729,437 probably benign Het
Enpp2 A T 15: 54,862,681 D566E probably damaging Het
Ezh1 T C 11: 101,194,917 K638R probably damaging Het
Fam172a A T 13: 77,761,922 Y98F probably damaging Het
Fdx1l C A 9: 21,073,398 G37W probably benign Het
Grin2b T C 6: 135,843,195 I340V probably benign Het
Ikbkap T A 4: 56,781,193 E493D probably benign Het
Il16 T C 7: 83,655,312 T671A probably benign Het
Kcnd2 T A 6: 21,216,357 M20K probably damaging Het
Kndc1 C T 7: 139,922,684 S962F probably damaging Het
L1td1 A G 4: 98,737,817 S750G possibly damaging Het
Lama2 A G 10: 27,208,370 C935R probably damaging Het
Lgalsl T C 11: 20,826,418 D158G possibly damaging Het
Lman1 A T 18: 65,993,073 probably null Het
Lmtk2 A G 5: 144,174,589 E709G probably damaging Het
Lrfn3 T C 7: 30,355,927 H531R possibly damaging Het
Mark3 A G 12: 111,623,325 probably benign Het
Mov10 T C 3: 104,795,174 E997G probably damaging Het
Myo15 T A 11: 60,504,331 W2484R probably benign Het
Myo1g G T 11: 6,509,372 Q833K probably benign Het
Ncoa3 T A 2: 166,055,510 D740E probably benign Het
Nol12 A G 15: 78,937,953 probably benign Het
Nrxn2 T A 19: 6,443,612 probably null Het
Nsfl1c A C 2: 151,500,746 I79L probably benign Het
Olfr1462 A G 19: 13,191,298 I210M probably benign Het
Olfr173 G T 16: 58,797,448 H133N probably benign Het
Olfr691 T C 7: 105,337,261 I152V probably benign Het
Osbpl8 A C 10: 111,291,581 E842A probably benign Het
Pdxk G T 10: 78,440,811 T310K probably benign Het
Phip T G 9: 82,959,605 K54Q probably damaging Het
Pklr A T 3: 89,143,035 D366V probably damaging Het
Plxna2 T A 1: 194,751,540 probably benign Het
Ppp4r3a A T 12: 101,043,524 V618E probably damaging Het
Prdm12 A T 2: 31,640,307 Q70L possibly damaging Het
Ptpn21 A T 12: 98,688,590 M706K probably damaging Het
Ptprq A T 10: 107,586,714 F1606I probably damaging Het
Rasgrp4 T C 7: 29,137,727 probably null Het
Rlbp1 C A 7: 79,379,913 probably null Het
Rtp2 T C 16: 23,927,443 D166G probably benign Het
Ryr3 A C 2: 112,645,259 F4481V probably damaging Het
Scn2a A G 2: 65,701,991 D649G possibly damaging Het
Slc30a5 T A 13: 100,803,442 D655V probably damaging Het
Slco5a1 G A 1: 12,871,908 A838V probably benign Het
Tceanc2 T C 4: 107,147,640 T104A probably benign Het
Tcp1 T C 17: 12,922,606 probably null Het
Unc13b C T 4: 43,239,385 R1056* probably null Het
Wdr19 G A 5: 65,223,504 probably benign Het
Zadh2 A G 18: 84,094,471 K91E probably benign Het
Zfhx4 T A 3: 5,241,859 H48Q probably benign Het
Zfp787 T A 7: 6,132,235 H339L probably damaging Het
Zfp839 G T 12: 110,860,899 R408L probably benign Het
Other mutations in Srprb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0308:Srprb UTSW 9 103202005 missense possibly damaging 0.64
R0739:Srprb UTSW 9 103197595 missense probably damaging 1.00
R1679:Srprb UTSW 9 103192207 splice site probably benign
R2370:Srprb UTSW 9 103197556 missense probably damaging 0.99
R2851:Srprb UTSW 9 103198839 nonsense probably null
R2853:Srprb UTSW 9 103198839 nonsense probably null
R4161:Srprb UTSW 9 103201330 missense possibly damaging 0.88
R4914:Srprb UTSW 9 103201948 missense possibly damaging 0.59
R5260:Srprb UTSW 9 103201920 missense probably damaging 1.00
R5588:Srprb UTSW 9 103198849 nonsense probably null
R5624:Srprb UTSW 9 103197601 missense probably damaging 1.00
R6052:Srprb UTSW 9 103190216 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ACTCTCAAAGCGATGCCCTCTCTG -3'
(R):5'- TGTCAATACCGACTGGTGCTATCCC -3'

Sequencing Primer
(F):5'- TGTCTCACACTAACATGATGCTAC -3'
(R):5'- TGCTATCCCTTTGATTTAGGAGC -3'
Posted On2014-03-14