Incidental Mutation 'R1434:Myo1g'
ID159394
Institutional Source Beutler Lab
Gene Symbol Myo1g
Ensembl Gene ENSMUSG00000020437
Gene Namemyosin IG
Synonyms
MMRRC Submission 039489-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1434 (G1)
Quality Score83
Status Validated
Chromosome11
Chromosomal Location6506548-6520965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6509372 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 833 (Q833K)
Ref Sequence ENSEMBL: ENSMUSP00000003459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003459] [ENSMUST00000144725]
Predicted Effect probably benign
Transcript: ENSMUST00000003459
AA Change: Q833K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000003459
Gene: ENSMUSG00000020437
AA Change: Q833K

DomainStartEndE-ValueType
MYSc 9 714 N/A SMART
IQ 715 737 2.79e0 SMART
Pfam:Myosin_TH1 821 1024 2.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134639
Predicted Effect probably benign
Transcript: ENSMUST00000144725
SMART Domains Protein: ENSMUSP00000120975
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Blast:MYSc 9 43 8e-14 BLAST
low complexity region 48 60 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156878
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.4%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYO1G is a plasma membrane-associated class I myosin (see MIM 601478) that is abundant in T and B lymphocytes and mast cells (Pierce et al., 2001 [PubMed 11544309]; Patino-Lopez et al., 2010 [PubMed 20071333]).[supplied by OMIM, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced B cell spreading, migration and homing and impaired T cell motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik G T 19: 28,927,639 probably benign Het
Abca12 G T 1: 71,309,800 H851N probably benign Het
Adamtsl4 T C 3: 95,680,784 Y631C probably damaging Het
Ankhd1 A G 18: 36,625,159 I969V probably benign Het
Apob A G 12: 8,009,715 I2699M probably damaging Het
Aqr A T 2: 114,150,409 L297Q probably damaging Het
BC067074 G A 13: 113,368,492 V510I possibly damaging Het
Camsap1 A G 2: 25,945,178 Y301H probably damaging Het
Ccdc88c A G 12: 100,939,166 probably benign Het
Cd209b T A 8: 3,923,367 I106F possibly damaging Het
Cdkn1b T A 6: 134,921,097 W60R probably damaging Het
Coasy A G 11: 101,084,996 probably benign Het
Col2a1 T A 15: 97,979,651 Q1017L probably damaging Het
Ctnnal1 T A 4: 56,847,971 N56I probably damaging Het
Cyb561d2 T A 9: 107,541,643 probably benign Het
Dcst1 G T 3: 89,352,519 T632N probably damaging Het
Ddx1 C T 12: 13,237,231 V267I probably benign Het
Dnah10 A T 5: 124,774,986 M1736L probably benign Het
Eln G A 5: 134,729,437 probably benign Het
Enpp2 A T 15: 54,862,681 D566E probably damaging Het
Ezh1 T C 11: 101,194,917 K638R probably damaging Het
Fam172a A T 13: 77,761,922 Y98F probably damaging Het
Fdx1l C A 9: 21,073,398 G37W probably benign Het
Grin2b T C 6: 135,843,195 I340V probably benign Het
Ikbkap T A 4: 56,781,193 E493D probably benign Het
Il16 T C 7: 83,655,312 T671A probably benign Het
Kcnd2 T A 6: 21,216,357 M20K probably damaging Het
Kndc1 C T 7: 139,922,684 S962F probably damaging Het
L1td1 A G 4: 98,737,817 S750G possibly damaging Het
Lama2 A G 10: 27,208,370 C935R probably damaging Het
Lgalsl T C 11: 20,826,418 D158G possibly damaging Het
Lman1 A T 18: 65,993,073 probably null Het
Lmtk2 A G 5: 144,174,589 E709G probably damaging Het
Lrfn3 T C 7: 30,355,927 H531R possibly damaging Het
Mark3 A G 12: 111,623,325 probably benign Het
Mov10 T C 3: 104,795,174 E997G probably damaging Het
Myo15 T A 11: 60,504,331 W2484R probably benign Het
Ncoa3 T A 2: 166,055,510 D740E probably benign Het
Nol12 A G 15: 78,937,953 probably benign Het
Nrxn2 T A 19: 6,443,612 probably null Het
Nsfl1c A C 2: 151,500,746 I79L probably benign Het
Olfr1462 A G 19: 13,191,298 I210M probably benign Het
Olfr173 G T 16: 58,797,448 H133N probably benign Het
Olfr691 T C 7: 105,337,261 I152V probably benign Het
Osbpl8 A C 10: 111,291,581 E842A probably benign Het
Pdxk G T 10: 78,440,811 T310K probably benign Het
Phip T G 9: 82,959,605 K54Q probably damaging Het
Pklr A T 3: 89,143,035 D366V probably damaging Het
Plxna2 T A 1: 194,751,540 probably benign Het
Ppp4r3a A T 12: 101,043,524 V618E probably damaging Het
Prdm12 A T 2: 31,640,307 Q70L possibly damaging Het
Ptpn21 A T 12: 98,688,590 M706K probably damaging Het
Ptprq A T 10: 107,586,714 F1606I probably damaging Het
Rasgrp4 T C 7: 29,137,727 probably null Het
Rlbp1 C A 7: 79,379,913 probably null Het
Rtp2 T C 16: 23,927,443 D166G probably benign Het
Ryr3 A C 2: 112,645,259 F4481V probably damaging Het
Scn2a A G 2: 65,701,991 D649G possibly damaging Het
Slc30a5 T A 13: 100,803,442 D655V probably damaging Het
Slco5a1 G A 1: 12,871,908 A838V probably benign Het
Srprb A G 9: 103,190,302 V239A probably damaging Het
Tceanc2 T C 4: 107,147,640 T104A probably benign Het
Tcp1 T C 17: 12,922,606 probably null Het
Unc13b C T 4: 43,239,385 R1056* probably null Het
Wdr19 G A 5: 65,223,504 probably benign Het
Zadh2 A G 18: 84,094,471 K91E probably benign Het
Zfhx4 T A 3: 5,241,859 H48Q probably benign Het
Zfp787 T A 7: 6,132,235 H339L probably damaging Het
Zfp839 G T 12: 110,860,899 R408L probably benign Het
Other mutations in Myo1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Myo1g APN 11 6515856 missense possibly damaging 0.70
IGL01608:Myo1g APN 11 6516780 missense possibly damaging 0.61
IGL01679:Myo1g APN 11 6518006 missense possibly damaging 0.90
IGL01830:Myo1g APN 11 6514522 nonsense probably null
IGL02332:Myo1g APN 11 6520766 missense possibly damaging 0.61
IGL02813:Myo1g APN 11 6518743 makesense probably null
IGL02988:Myo1g APN 11 6508183 splice site probably benign
IGL03178:Myo1g APN 11 6512181 missense probably damaging 1.00
R0004:Myo1g UTSW 11 6515901 missense probably damaging 1.00
R0334:Myo1g UTSW 11 6511084 splice site probably benign
R0513:Myo1g UTSW 11 6510203 missense probably benign 0.00
R0730:Myo1g UTSW 11 6520794 missense probably damaging 1.00
R1054:Myo1g UTSW 11 6518987 missense probably damaging 1.00
R1500:Myo1g UTSW 11 6520811 missense probably benign
R1513:Myo1g UTSW 11 6515140 missense probably damaging 0.99
R1720:Myo1g UTSW 11 6512490 missense probably benign 0.44
R1774:Myo1g UTSW 11 6515988 missense probably damaging 1.00
R1809:Myo1g UTSW 11 6512283 missense probably benign 0.02
R1957:Myo1g UTSW 11 6512159 critical splice donor site probably null
R1978:Myo1g UTSW 11 6520829 missense possibly damaging 0.53
R2212:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R2438:Myo1g UTSW 11 6511542 missense probably damaging 1.00
R2566:Myo1g UTSW 11 6512539 critical splice acceptor site probably null
R3158:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3159:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3413:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R3816:Myo1g UTSW 11 6510926 missense probably benign 0.02
R3872:Myo1g UTSW 11 6514886 missense possibly damaging 0.94
R3946:Myo1g UTSW 11 6520760 missense possibly damaging 0.89
R4551:Myo1g UTSW 11 6517874 missense probably damaging 1.00
R4625:Myo1g UTSW 11 6512240 missense probably damaging 1.00
R4630:Myo1g UTSW 11 6519047 missense probably damaging 1.00
R4700:Myo1g UTSW 11 6516785 unclassified probably null
R4713:Myo1g UTSW 11 6516080 missense probably null 1.00
R4964:Myo1g UTSW 11 6515976 missense probably damaging 1.00
R5183:Myo1g UTSW 11 6508243 missense probably damaging 1.00
R5191:Myo1g UTSW 11 6515105 missense probably benign
R5192:Myo1g UTSW 11 6514816 missense probably damaging 1.00
R5726:Myo1g UTSW 11 6509420 missense probably benign 0.06
R5841:Myo1g UTSW 11 6507000 missense probably benign 0.05
R5942:Myo1g UTSW 11 6514888 missense probably damaging 1.00
R6225:Myo1g UTSW 11 6519168 missense probably damaging 1.00
R6517:Myo1g UTSW 11 6512509 missense probably damaging 0.99
R6563:Myo1g UTSW 11 6517146 missense possibly damaging 0.91
X0017:Myo1g UTSW 11 6516077 critical splice donor site probably null
X0061:Myo1g UTSW 11 6517967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGCATGAACCCTTAGGACAGGAC -3'
(R):5'- GCTACGGACACTGAGTACAAAGGAC -3'

Sequencing Primer
(F):5'- CCCTTAGGACAGGACCAAGAAG -3'
(R):5'- aacagaaacaaaacaaaacaacaac -3'
Posted On2014-03-14