Incidental Mutation 'R1435:Tnfsf14'
ID159486
Institutional Source Beutler Lab
Gene Symbol Tnfsf14
Ensembl Gene ENSMUSG00000005824
Gene Nametumor necrosis factor (ligand) superfamily, member 14
SynonymsLIGHT, HVEM-L
MMRRC Submission 039490-MU
Accession Numbers

Ncbi RefSeq: 019418.2; MGI: 1355317

Is this an essential gene? Probably non essential (E-score: 0.043) question?
Stock #R1435 (G1)
Quality Score163
Status Not validated
Chromosome17
Chromosomal Location57189492-57194189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57190605 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 209 (E209V)
Ref Sequence ENSEMBL: ENSMUSP00000005976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005976]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005976
AA Change: E209V

PolyPhen 2 Score 0.595 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000005976
Gene: ENSMUSG00000005824
AA Change: E209V

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 92 239 1.22e-49 SMART
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.0%
  • 20x: 81.3%
Validation Efficiency
MGI Phenotype Strain: 2668383; 2671122; 2180198
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene leads to selective impairment of CD8+ T cell function. Mice homozygous for a knock-out allele exhibit defects in CD8+ T cell-mediated allogenic responses. Mice homozygous for a different knock-out allele show increased resistance to experimentally-induced hepatitis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,326,082 T209A probably benign Het
Acadvl T G 11: 70,014,816 T62P probably benign Het
AF067061 T A 13: 120,263,988 W63R probably damaging Het
Amz1 A T 5: 140,748,166 N166Y probably damaging Het
Anxa6 T C 11: 54,991,410 Q518R probably benign Het
Aox3 G A 1: 58,163,446 probably null Het
Arid1a C T 4: 133,680,698 R2166Q unknown Het
Armc4 T A 18: 7,222,646 H541L probably benign Het
Asb4 T G 6: 5,398,410 I125S probably benign Het
Aspscr1 T C 11: 120,689,222 S196P probably benign Het
Atxn3 A G 12: 101,942,201 F131L probably benign Het
B3gnt5 T A 16: 19,769,174 Y48N probably damaging Het
Bglap3 A G 3: 88,369,146 M35T possibly damaging Het
Cabp1 A T 5: 115,173,208 D79E probably damaging Het
Chd2 C T 7: 73,453,136 R1367Q probably damaging Het
Clec5a T A 6: 40,584,424 Q29L probably damaging Het
Cmtr2 T C 8: 110,221,079 L7P probably benign Het
Cnbd1 T C 4: 18,907,026 I183V probably benign Het
Col7a1 G A 9: 108,963,273 G1297D unknown Het
Csnk1g3 G A 18: 53,906,674 probably null Het
Cyp4a32 A T 4: 115,606,666 N134I probably damaging Het
Cyp4f16 CTATG CTATGTATG 17: 32,550,734 probably null Het
Dst G A 1: 34,113,945 V56M probably damaging Het
Engase A T 11: 118,484,901 T32S probably damaging Het
Fam117b T C 1: 59,969,063 I352T possibly damaging Het
Golga4 C A 9: 118,535,440 D290E probably benign Het
Gtf2a1l C A 17: 88,694,315 H153N probably damaging Het
Hivep1 C A 13: 42,158,043 T1253N probably damaging Het
Hps1 T C 19: 42,762,275 S398G probably benign Het
Il1r2 T A 1: 40,105,299 F49I probably damaging Het
Iqsec1 A G 6: 90,672,024 S808P probably damaging Het
Lrrk1 A G 7: 66,273,028 L289P probably damaging Het
Magi2 T A 5: 20,358,945 D358E probably damaging Het
Man2b2 A G 5: 36,813,067 W832R probably damaging Het
Mfsd4a G T 1: 132,067,756 T46K probably damaging Het
N4bp3 G A 11: 51,644,340 R341W probably damaging Het
Olfr284 A T 15: 98,340,328 H220Q possibly damaging Het
Olfr568 T C 7: 102,877,767 S216P probably damaging Het
Otof A G 5: 30,378,695 L1353S probably benign Het
Pcsk5 A T 19: 17,563,882 C844* probably null Het
Pdk2 T C 11: 95,031,895 Y153C probably damaging Het
Pes1 T C 11: 3,976,075 V292A probably benign Het
Pex14 T C 4: 148,963,527 T198A probably benign Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pnpla2 G A 7: 141,457,411 R109H probably benign Het
Polh G A 17: 46,194,255 T145I probably damaging Het
Polr3d A T 14: 70,440,039 V299E probably benign Het
Polr3e C T 7: 120,940,788 T586M probably benign Het
Rbm20 T A 19: 53,814,157 F365L probably benign Het
Rnf213 G T 11: 119,436,005 C1606F probably damaging Het
Sipa1l2 A G 8: 125,468,725 V758A probably damaging Het
Slc22a16 T A 10: 40,587,607 M451K probably damaging Het
Slc28a1 T C 7: 81,153,517 S359P probably damaging Het
Slc45a1 G T 4: 150,644,048 F99L probably damaging Het
Sp3 A T 2: 72,938,156 N754K possibly damaging Het
Taf4b A T 18: 14,807,409 Q315L probably damaging Het
Tmem2 A T 19: 21,844,706 Q1155L probably benign Het
Tmprss15 A T 16: 79,021,454 N544K probably benign Het
Tnfsf13b A G 8: 10,035,358 I283V probably benign Het
Uckl1 T G 2: 181,573,133 S283R probably benign Het
Ush1g T C 11: 115,318,468 D300G probably damaging Het
Virma C T 4: 11,528,621 A1286V probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r59 A T 7: 42,046,205 M261K possibly damaging Het
Vwf A T 6: 125,642,249 K1297* probably null Het
Zdbf2 G A 1: 63,303,040 E193K possibly damaging Het
Zfp759 T G 13: 67,138,766 I127S possibly damaging Het
Other mutations in Tnfsf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Tnfsf14 APN 17 57192562 missense possibly damaging 0.89
IGL00962:Tnfsf14 APN 17 57192906 nonsense probably null
IGL02515:Tnfsf14 APN 17 57192600 missense probably benign
P0015:Tnfsf14 UTSW 17 57190815 missense probably damaging 1.00
R1566:Tnfsf14 UTSW 17 57193876 missense probably benign
R1791:Tnfsf14 UTSW 17 57190867 missense probably damaging 1.00
R1967:Tnfsf14 UTSW 17 57190807 missense probably damaging 1.00
R2108:Tnfsf14 UTSW 17 57190867 missense probably damaging 1.00
R2202:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2203:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2204:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2205:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2232:Tnfsf14 UTSW 17 57193876 missense probably benign
R4790:Tnfsf14 UTSW 17 57190740 missense probably damaging 1.00
R5434:Tnfsf14 UTSW 17 57192592 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAGGACTTCAAACCCTATTGCTG -3'
(R):5'- TGGACCTCTGTTATGGGAGACACG -3'

Sequencing Primer
(F):5'- AACCCTATTGCTGGGTTTGAG -3'
(R):5'- TGTGTACTCCAAAGTGCAGC -3'
Posted On2014-03-14