Incidental Mutation 'R1350:Hepacam2'
ID159525
Institutional Source Beutler Lab
Gene Symbol Hepacam2
Ensembl Gene ENSMUSG00000044156
Gene NameHEPACAM family member 2
Synonyms
MMRRC Submission 039415-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R1350 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3457096-3498298 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 3467530 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 384 (Q384*)
Ref Sequence ENSEMBL: ENSMUSP00000058882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049985]
Predicted Effect probably null
Transcript: ENSMUST00000049985
AA Change: Q384*
SMART Domains Protein: ENSMUSP00000058882
Gene: ENSMUSG00000044156
AA Change: Q384*

DomainStartEndE-ValueType
IG 39 142 7.77e-1 SMART
IGc2 165 227 6.21e-9 SMART
IG 256 334 1.87e0 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201276
Meta Mutation Damage Score 0.606 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.9%
  • 20x: 88.1%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the immunoglobulin superfamily that plays a role in mitosis. Knockdown of this gene results in prometaphase arrest, abnormal nuclear morphology and apoptosis. Poly(ADP-ribosylation) of the encoded protein promotes its translocation to centrosomes, which may stimulate centrosome maturation. A chromosomal deletion including this gene may be associated with myeloid leukemia and myelodysplastic syndrome in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago4 A G 4: 126,507,132 V640A probably benign Het
AI661453 C T 17: 47,467,928 Q860* probably null Het
Atp10d A G 5: 72,261,126 probably benign Het
Axdnd1 A G 1: 156,378,380 probably null Het
Bivm T A 1: 44,126,703 N104K possibly damaging Het
Capn15 A G 17: 25,964,692 S338P probably benign Het
Car9 G T 4: 43,512,439 probably null Het
Col13a1 G A 10: 61,894,069 probably benign Het
Crb2 A G 2: 37,792,069 N821D probably damaging Het
D5Ertd579e T A 5: 36,613,737 I1105F probably damaging Het
Dnaja2 A T 8: 85,540,088 F337I probably damaging Het
Dntt C T 19: 41,037,139 probably benign Het
Dock3 C T 9: 106,914,632 E1381K possibly damaging Het
Fam213b C A 4: 154,898,128 R107L probably damaging Het
Fibp T C 19: 5,461,391 Y96H probably damaging Het
Garnl3 A G 2: 33,052,214 V85A probably damaging Het
Gsdme A T 6: 50,246,128 probably null Het
Gucy2c A T 6: 136,743,914 probably null Het
Hectd1 A G 12: 51,762,434 V1748A probably benign Het
Itga10 T A 3: 96,657,477 M961K probably benign Het
Kcnk1 C T 8: 126,025,228 T191I probably benign Het
Khdrbs1 G A 4: 129,720,752 P336L probably benign Het
Klhdc2 T A 12: 69,305,710 probably null Het
Lipc T C 9: 70,798,367 H478R probably benign Het
Lrp12 A T 15: 39,878,250 C356* probably null Het
Nf1 T A 11: 79,412,687 C397S probably damaging Het
Nox3 A G 17: 3,650,121 F439S probably damaging Het
Olfr1121 T A 2: 87,372,357 V275E probably benign Het
Olfr1271 A T 2: 90,266,346 L28Q probably damaging Het
Olfr401 T C 11: 74,122,213 L308P possibly damaging Het
Olfr46 T C 7: 140,610,709 V181A probably damaging Het
Olfr64 A G 7: 103,893,730 W2R probably benign Het
Olfr847 T G 9: 19,375,414 S156R possibly damaging Het
Olfr884 G A 9: 38,047,815 V198I probably benign Het
Pcif1 T C 2: 164,886,767 F288L probably damaging Het
Skint7 G T 4: 111,980,324 A100S possibly damaging Het
Ssu2 A T 6: 112,374,846 L306* probably null Het
Tasp1 T C 2: 140,057,421 E4G probably damaging Het
Tfb1m A T 17: 3,545,680 D99E probably benign Het
Ube3b A G 5: 114,406,137 probably null Het
Uox A G 3: 146,624,575 D162G probably damaging Het
Usp18 A G 6: 121,262,692 T249A possibly damaging Het
Vmn1r202 T C 13: 22,501,716 N177S probably benign Het
Vwa2 T A 19: 56,909,126 M621K probably damaging Het
Wdfy3 C A 5: 101,898,552 D1797Y probably damaging Het
Wisp3 C T 10: 39,158,306 C100Y probably damaging Het
Ylpm1 A T 12: 85,014,082 probably benign Het
Zbtb9 G A 17: 26,974,406 V262I probably benign Het
Other mutations in Hepacam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL01945:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL02254:Hepacam2 APN 6 3483421 missense probably benign 0.06
IGL02445:Hepacam2 APN 6 3483481 missense probably damaging 1.00
IGL02546:Hepacam2 APN 6 3483568 missense possibly damaging 0.93
IGL02620:Hepacam2 APN 6 3487280 splice site probably benign
IGL02697:Hepacam2 APN 6 3476036 missense possibly damaging 0.79
R0089:Hepacam2 UTSW 6 3487094 missense probably damaging 0.96
R0208:Hepacam2 UTSW 6 3467505 splice site probably benign
R0230:Hepacam2 UTSW 6 3463336 missense probably benign 0.01
R0299:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0499:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0608:Hepacam2 UTSW 6 3483479 missense possibly damaging 0.93
R1663:Hepacam2 UTSW 6 3483439 missense possibly damaging 0.76
R1749:Hepacam2 UTSW 6 3483379 missense probably damaging 1.00
R1997:Hepacam2 UTSW 6 3487241 missense probably damaging 1.00
R2146:Hepacam2 UTSW 6 3463378 splice site probably benign
R3911:Hepacam2 UTSW 6 3494477 start codon destroyed probably null 0.98
R4281:Hepacam2 UTSW 6 3475938 missense probably damaging 0.98
R4290:Hepacam2 UTSW 6 3487237 missense probably benign 0.01
R4371:Hepacam2 UTSW 6 3486988 missense probably damaging 1.00
R4794:Hepacam2 UTSW 6 3475933 missense probably damaging 0.96
R4890:Hepacam2 UTSW 6 3487231 missense probably damaging 0.96
R5330:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5331:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5677:Hepacam2 UTSW 6 3466142 missense probably damaging 1.00
R5796:Hepacam2 UTSW 6 3466200 unclassified probably null
R5844:Hepacam2 UTSW 6 3476073 missense probably damaging 0.99
R5979:Hepacam2 UTSW 6 3476149 missense probably damaging 1.00
R6017:Hepacam2 UTSW 6 3483332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTCCAGAAGCTACGAAAGTCC -3'
(R):5'- GCTTGCACAAAGGGGAAAATCCCTG -3'

Sequencing Primer
(F):5'- GAAGCTACGAAAGTCCTCCTTTG -3'
(R):5'- TGTCCCCACTAGCAAGTATAACTG -3'
Posted On2014-03-14