Incidental Mutation 'R1412:Arl6ip1'
ID159633
Institutional Source Beutler Lab
Gene Symbol Arl6ip1
Ensembl Gene ENSMUSG00000030654
Gene NameADP-ribosylation factor-like 6 interacting protein 1
SynonymsAIP-6, ARMER
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R1412 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118118891-118129662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118120368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 179 (I179T)
Ref Sequence ENSEMBL: ENSMUSP00000032888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032888] [ENSMUST00000106588] [ENSMUST00000106590] [ENSMUST00000128482] [ENSMUST00000131374] [ENSMUST00000131840] [ENSMUST00000203154] [ENSMUST00000204005] [ENSMUST00000206491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032888
AA Change: I179T

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032888
Gene: ENSMUSG00000030654
AA Change: I179T

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 136 153 N/A INTRINSIC
transmembrane domain 158 180 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106588
SMART Domains Protein: ENSMUSP00000102198
Gene: ENSMUSG00000008683

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 130 1.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106590
SMART Domains Protein: ENSMUSP00000102200
Gene: ENSMUSG00000008683

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 108 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128482
SMART Domains Protein: ENSMUSP00000114544
Gene: ENSMUSG00000008683

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 68 9.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131374
SMART Domains Protein: ENSMUSP00000119975
Gene: ENSMUSG00000008683

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 130 1.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131840
SMART Domains Protein: ENSMUSP00000116061
Gene: ENSMUSG00000008683

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 67 1.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203154
Predicted Effect probably benign
Transcript: ENSMUST00000204005
SMART Domains Protein: ENSMUSP00000145418
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205182
Predicted Effect probably benign
Transcript: ENSMUST00000206491
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ARL6ip family and encodes a transmembrane protein that is predominantly localized to intracytoplasmic membranes. It is highly expressed in early myeloid progenitor cells and thought to be involved in protein transport, membrane trafficking, or cell signaling during hematopoietic maturation. Mutations in this gene are associated with spastic paraplegia 61 (SPG61). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Arl6ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4155:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4156:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4157:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4201:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4206:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4271:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4276:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4277:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4278:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4280:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4281:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4283:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4330:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4502:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4503:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4547:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4548:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4580:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4604:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4774:Arl6ip1 UTSW 7 118121985 missense probably damaging 1.00
R4804:Arl6ip1 UTSW 7 118129552 utr 5 prime probably null
R4805:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R4807:Arl6ip1 UTSW 7 118121899 critical splice donor site probably benign
R6211:Arl6ip1 UTSW 7 118127250 missense probably benign 0.44
R6651:Arl6ip1 UTSW 7 118129485 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCCTCAGCAGAAGTGGTAAACCC -3'
(R):5'- CATTAAAGCCAGGTAGGTCGTGAGC -3'

Sequencing Primer
(F):5'- GTAGAACCAGCTTCCTGTAGC -3'
(R):5'- GTCCACCCACATTCAACTGTAGT -3'
Posted On2014-03-14