Incidental Mutation 'R1412:Socs2'
ID159643
Institutional Source Beutler Lab
Gene Symbol Socs2
Ensembl Gene ENSMUSG00000020027
Gene Namesuppressor of cytokine signaling 2
SynonymsCIS2, D130043N08Rik, cytokine-inducible SH2 protein 2, STAT-induced STAT inhibitor 2, Cish2, SOCS-2, JAB, SSI-2
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1412 (G1)
Quality Score165
Status Validated
Chromosome10
Chromosomal Location95385362-95417180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95414918 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 18 (S18G)
Ref Sequence ENSEMBL: ENSMUSP00000131875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020215] [ENSMUST00000119917] [ENSMUST00000129942] [ENSMUST00000135822] [ENSMUST00000150432] [ENSMUST00000170690] [ENSMUST00000172070]
Predicted Effect probably benign
Transcript: ENSMUST00000020215
AA Change: S18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020215
Gene: ENSMUSG00000020027
AA Change: S18G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119917
AA Change: S18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113378
Gene: ENSMUSG00000020027
AA Change: S18G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128854
Predicted Effect probably benign
Transcript: ENSMUST00000129942
AA Change: S18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117576
Gene: ENSMUSG00000020027
AA Change: S18G

DomainStartEndE-ValueType
SCOP:d1a81a2 30 62 8e-4 SMART
PDB:4JGH|A 45 62 7e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134918
Predicted Effect probably benign
Transcript: ENSMUST00000135822
AA Change: S18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118720
Gene: ENSMUSG00000020027
AA Change: S18G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
Pfam:SH2 48 80 1.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139210
SMART Domains Protein: ENSMUSP00000121305
Gene: ENSMUSG00000020027

DomainStartEndE-ValueType
SH2 1 89 5.07e-20 SMART
SOCS 108 149 3.15e-16 SMART
SOCS_box 114 148 1.06e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145847
Predicted Effect probably benign
Transcript: ENSMUST00000150432
AA Change: S18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117785
Gene: ENSMUSG00000020027
AA Change: S18G

DomainStartEndE-ValueType
SCOP:d1bg1a3 40 70 3e-7 SMART
PDB:2C9W|A 45 70 5e-12 PDB
Blast:SH2 46 70 8e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155148
Predicted Effect probably benign
Transcript: ENSMUST00000170690
AA Change: S18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129331
Gene: ENSMUSG00000020027
AA Change: S18G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172070
AA Change: S18G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131875
Gene: ENSMUSG00000020027
AA Change: S18G

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
SH2 46 135 5.22e-22 SMART
SOCS 154 195 3.15e-16 SMART
SOCS_box 160 194 1.06e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181781
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling (SOCS) family. SOCS family members are cytokine-inducible negative regulators of cytokine receptor signaling via the Janus kinase/signal transducer and activation of transcription pathway (the JAK/STAT pathway). SOCS family proteins interact with major molecules of signaling complexes to block further signal transduction, in part, by proteasomal depletion of receptors or signal-transducing proteins via ubiquitination. The expression of this gene can be induced by a subset of cytokines, including erythropoietin, GM-CSF, IL10, interferon (IFN)-gamma and by cytokine receptors such as growth horomone receptor. The protein encoded by this gene interacts with the cytoplasmic domain of insulin-like growth factor-1 receptor (IGF1R) and is thought to be involved in the regulation of IGF1R mediated cell signaling. This gene has pseudogenes on chromosomes 20 and 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mutations in this gene cause accelerated postnatal growth. Homozygotes for a targeted mutation also show increased bone growth, enlargement of most organs, collagen deposition in the skin and some ducts and vessels, lower major urinary protein levels, and elevated IGF-I mRNA levels in some tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Socs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03064:Socs2 APN 10 95412851 nonsense probably null
samson UTSW 10 95413081 nonsense probably null
R1617:Socs2 UTSW 10 95413081 nonsense probably null
R1921:Socs2 UTSW 10 95413038 nonsense probably null
R5261:Socs2 UTSW 10 95392819 missense unknown
R5638:Socs2 UTSW 10 95392883 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTAGTTCCATCGCTTTCAGTGCC -3'
(R):5'- CGAGAGACTTTGCCACACCATTCTG -3'

Sequencing Primer
(F):5'- TCAGTGCCCCCAACCTG -3'
(R):5'- ACACCATTCTGCCGGAATTTG -3'
Posted On2014-03-14