Incidental Mutation 'R1412:Parp10'
ID159650
Institutional Source Beutler Lab
Gene Symbol Parp10
Ensembl Gene ENSMUSG00000063268
Gene Namepoly (ADP-ribose) polymerase family, member 10
Synonyms
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R1412 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76231174-76243441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76243084 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 51 (L51P)
Ref Sequence ENSEMBL: ENSMUSP00000129765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023225] [ENSMUST00000075689] [ENSMUST00000165738] [ENSMUST00000229380] [ENSMUST00000229772] [ENSMUST00000230347]
Predicted Effect probably benign
Transcript: ENSMUST00000023225
SMART Domains Protein: ENSMUSP00000023225
Gene: ENSMUSG00000022564

DomainStartEndE-ValueType
low complexity region 27 101 N/A INTRINSIC
Pfam:Bax1-I 133 340 6.9e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075689
AA Change: L51P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075110
Gene: ENSMUSG00000063268
AA Change: L51P

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165738
AA Change: L51P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129765
Gene: ENSMUSG00000063268
AA Change: L51P

DomainStartEndE-ValueType
Blast:RRM_2 9 72 1e-13 BLAST
PDB:2DHX|A 9 98 1e-30 PDB
low complexity region 183 193 N/A INTRINSIC
low complexity region 275 285 N/A INTRINSIC
low complexity region 566 575 N/A INTRINSIC
low complexity region 579 593 N/A INTRINSIC
UIM 605 624 9.27e1 SMART
UIM 628 647 1.88e1 SMART
low complexity region 728 738 N/A INTRINSIC
Pfam:PARP 766 954 8.1e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166151
Predicted Effect probably benign
Transcript: ENSMUST00000229380
Predicted Effect probably benign
Transcript: ENSMUST00000229772
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229916
Predicted Effect probably benign
Transcript: ENSMUST00000230347
Meta Mutation Damage Score 0.262 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) polymerases (PARPs), such as PARP10, regulate gene transcription by altering chromatin organization by adding ADP-ribose to histones. PARPs can also function as transcriptional cofactors (Yu et al., 2005 [PubMed 15674325]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Parp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Parp10 APN 15 76241677 missense probably benign 0.09
IGL01419:Parp10 APN 15 76241388 missense probably damaging 1.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0053:Parp10 UTSW 15 76242246 missense probably damaging 1.00
R0126:Parp10 UTSW 15 76243066 missense probably damaging 0.98
R0207:Parp10 UTSW 15 76242633 missense probably benign 0.00
R1300:Parp10 UTSW 15 76241990 missense possibly damaging 0.93
R1510:Parp10 UTSW 15 76241417 missense probably damaging 1.00
R1670:Parp10 UTSW 15 76242070 missense probably benign 0.01
R1875:Parp10 UTSW 15 76242851 missense probably damaging 1.00
R2219:Parp10 UTSW 15 76233583 missense probably damaging 1.00
R2351:Parp10 UTSW 15 76242856 missense probably benign
R4027:Parp10 UTSW 15 76241154 critical splice donor site probably null
R4659:Parp10 UTSW 15 76242985 missense probably damaging 1.00
R4763:Parp10 UTSW 15 76233427 missense probably damaging 0.99
R4828:Parp10 UTSW 15 76243081 missense probably benign 0.00
R5066:Parp10 UTSW 15 76240946 splice site probably benign
R5090:Parp10 UTSW 15 76241725 missense probably damaging 0.97
R5495:Parp10 UTSW 15 76243166 missense probably benign
R6271:Parp10 UTSW 15 76242002 missense probably benign
R6335:Parp10 UTSW 15 76242188 missense probably benign 0.00
R6503:Parp10 UTSW 15 76242484 missense probably damaging 1.00
R6606:Parp10 UTSW 15 76240108 missense possibly damaging 0.66
R6868:Parp10 UTSW 15 76243106 missense probably damaging 1.00
X0027:Parp10 UTSW 15 76241504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGCTCCAGACTCAGAGGTGAAG -3'
(R):5'- AGGCATAACTGACTGGCCTGAGAC -3'

Sequencing Primer
(F):5'- TGTTGGAGAAGCACACGTTC -3'
(R):5'- TGAGACACTGGCCTGAGAC -3'
Posted On2014-03-14