Incidental Mutation 'R1412:Smim22'
ID159651
Institutional Source Beutler Lab
Gene Symbol Smim22
Ensembl Gene ENSMUSG00000096215
Gene Namesmall integral membrane protein 22
SynonymsGm5480
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1412 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location5007288-5008309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 5007785 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 11 (E11D)
Ref Sequence ENSEMBL: ENSMUSP00000139067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023191] [ENSMUST00000090453] [ENSMUST00000178155] [ENSMUST00000184256] [ENSMUST00000184439] [ENSMUST00000185147] [ENSMUST00000201077] [ENSMUST00000202281]
Predicted Effect probably benign
Transcript: ENSMUST00000023191
SMART Domains Protein: ENSMUSP00000023191
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 298 9.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090453
SMART Domains Protein: ENSMUSP00000087938
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 210 1.2e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000178155
AA Change: E11D

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000137083
Gene: ENSMUSG00000096215
AA Change: E11D

DomainStartEndE-ValueType
Pfam:DUF4713 10 65 5.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183821
Predicted Effect probably benign
Transcript: ENSMUST00000184256
SMART Domains Protein: ENSMUSP00000138990
Gene: ENSMUSG00000096215

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000184439
AA Change: E11D

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139370
Gene: ENSMUSG00000096215
AA Change: E11D

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000185147
AA Change: E11D

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139067
Gene: ENSMUSG00000096215
AA Change: E11D

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201077
SMART Domains Protein: ENSMUSP00000144166
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 12 134 7.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201118
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201726
Predicted Effect probably benign
Transcript: ENSMUST00000202281
SMART Domains Protein: ENSMUSP00000144481
Gene: ENSMUSG00000022540

DomainStartEndE-ValueType
Pfam:Rogdi_lz 18 276 4.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202998
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Smim22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Smim22 APN 16 5007996 missense probably damaging 0.99
R4556:Smim22 UTSW 16 5007866 missense possibly damaging 0.92
R4890:Smim22 UTSW 16 5007858 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGGAATCAGCTTTGCTGGGGAG -3'
(R):5'- AACAACAGCACAGTGCCTGGAG -3'

Sequencing Primer
(F):5'- CCAGGTCAGGGTCAGTGTG -3'
(R):5'- CAGTGCCTGGAGACCAGAG -3'
Posted On2014-03-14