Incidental Mutation 'R1412:Vmn1r234'
ID159652
Institutional Source Beutler Lab
Gene Symbol Vmn1r234
Ensembl Gene ENSMUSG00000057203
Gene Namevomeronasal 1 receptor 234
SynonymsV1rf1
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R1412 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21228826-21229815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21229250 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 142 (I142N)
Ref Sequence ENSEMBL: ENSMUSP00000078579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079633]
Predicted Effect probably benign
Transcript: ENSMUST00000079633
AA Change: I142N

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000078579
Gene: ENSMUSG00000057203
AA Change: I142N

DomainStartEndE-ValueType
Pfam:TAS2R 25 315 2.8e-14 PFAM
Pfam:V1R 57 318 2.3e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177028
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Vmn1r234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn1r234 APN 17 21229598 missense possibly damaging 0.95
IGL01485:Vmn1r234 APN 17 21228909 missense possibly damaging 0.53
IGL02149:Vmn1r234 APN 17 21229007 missense probably benign 0.00
IGL02291:Vmn1r234 APN 17 21228931 missense probably benign 0.28
IGL02993:Vmn1r234 APN 17 21229703 missense probably damaging 0.99
IGL03223:Vmn1r234 APN 17 21229391 missense probably damaging 0.98
R0626:Vmn1r234 UTSW 17 21229745 missense probably benign 0.17
R1274:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1275:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1288:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1289:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1319:Vmn1r234 UTSW 17 21228910 missense probably benign 0.01
R2323:Vmn1r234 UTSW 17 21229703 missense probably benign 0.10
R3755:Vmn1r234 UTSW 17 21229009 missense probably damaging 0.98
R4299:Vmn1r234 UTSW 17 21229021 missense probably benign 0.03
R5301:Vmn1r234 UTSW 17 21229327 missense probably benign 0.11
R5741:Vmn1r234 UTSW 17 21229469 missense probably benign 0.21
R6197:Vmn1r234 UTSW 17 21229327 missense probably benign 0.04
R6218:Vmn1r234 UTSW 17 21229721 missense possibly damaging 0.71
R6486:Vmn1r234 UTSW 17 21229342 missense probably benign 0.11
X0028:Vmn1r234 UTSW 17 21228890 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTGTTCCACAAGCAATGGCAGC -3'
(R):5'- CTGTGCCTGTGCAAAATGAGAACC -3'

Sequencing Primer
(F):5'- CACAAGCAATGGCAGCTTTTG -3'
(R):5'- CATTGCACAATTTTGCAGACAT -3'
Posted On2014-03-14