Incidental Mutation 'R1412:1810009A15Rik'
List [record 1 of 19097] next >> last >|
Institutional Source Beutler Lab
Gene Symbol 1810009A15Rik
Ensembl Gene ENSMUSG00000071653
Gene NameRIKEN cDNA 1810009A15 gene
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R1412 (G1)
Quality Score225
Status Validated
Chromosomal Location8888853-8890881 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 8889995 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096249] [ENSMUST00000096251] [ENSMUST00000177826] [ENSMUST00000185488] [ENSMUST00000187504] [ENSMUST00000191089]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093658
Predicted Effect probably benign
Transcript: ENSMUST00000096249
SMART Domains Protein: ENSMUSP00000093968
Gene: ENSMUSG00000071652

low complexity region 7 25 N/A INTRINSIC
Pfam:INTS5_N 29 252 1e-82 PFAM
low complexity region 254 267 N/A INTRINSIC
Pfam:INTS5_C 289 998 2.2e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096251
SMART Domains Protein: ENSMUSP00000093970
Gene: ENSMUSG00000071653

low complexity region 15 37 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175573
Predicted Effect probably benign
Transcript: ENSMUST00000177826
SMART Domains Protein: ENSMUSP00000137432
Gene: ENSMUSG00000116166

Pfam:Lbh 1 101 1.6e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185488
SMART Domains Protein: ENSMUSP00000140221
Gene: ENSMUSG00000071653

low complexity region 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187037
Predicted Effect probably benign
Transcript: ENSMUST00000187504
SMART Domains Protein: ENSMUSP00000139692
Gene: ENSMUSG00000096740

Pfam:Lbh 1 101 2.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190843
Predicted Effect probably benign
Transcript: ENSMUST00000191089
SMART Domains Protein: ENSMUSP00000140564
Gene: ENSMUSG00000116347

low complexity region 15 37 N/A INTRINSIC
Meta Mutation Damage Score 0.0504 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in 1810009A15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0948:1810009A15Rik UTSW 19 8890026 missense probably damaging 1.00
R0960:1810009A15Rik UTSW 19 8890428 missense probably benign
R2887:1810009A15Rik UTSW 19 8890031 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctcacaaccatccataacaaaaatc -3'
Posted On2014-03-14