Incidental Mutation 'R1413:Pappa2'
ID159661
Institutional Source Beutler Lab
Gene Symbol Pappa2
Ensembl Gene ENSMUSG00000073530
Gene Namepappalysin 2
Synonymspregnancy-associated plasma preproprotein-A2, placenta-specific 3, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
MMRRC Submission 039469-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1413 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location158711727-158980490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158936554 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 462 (D462E)
Ref Sequence ENSEMBL: ENSMUSP00000124022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159861]
Predicted Effect probably benign
Transcript: ENSMUST00000159861
AA Change: D462E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000124022
Gene: ENSMUSG00000073530
AA Change: D462E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Laminin_G_3 271 440 1.2e-25 PFAM
NL 572 614 2.81e-5 SMART
Pfam:Peptidase_M43 669 832 1.5e-12 PFAM
Blast:FN3 844 1103 1e-169 BLAST
low complexity region 1130 1139 N/A INTRINSIC
low complexity region 1361 1370 N/A INTRINSIC
CCP 1394 1457 4.97e0 SMART
CCP 1462 1519 4.81e-1 SMART
CCP 1523 1588 2.58e-4 SMART
CCP 1593 1644 1.13e0 SMART
NL 1720 1757 2.66e-6 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile but display postnatal growth retardation that is more pronounced in females compared to males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,590,496 V1504A probably damaging Het
Abcc9 T C 6: 142,627,519 N1051D possibly damaging Het
Actr6 A T 10: 89,728,157 Y84* probably null Het
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,587 probably benign Het
Amd1 A T 10: 40,290,408 C157* probably null Het
Ank1 G A 8: 23,119,377 E1362K probably damaging Het
Atp10b A G 11: 43,230,564 Q1018R probably benign Het
Atp1a2 G A 1: 172,279,344 T803I probably damaging Het
Atr T G 9: 95,932,442 L2064R probably damaging Het
Bmp3 T A 5: 98,872,405 L229Q probably damaging Het
Ccl25 A G 8: 4,353,892 *54W probably null Het
Cdc45 A T 16: 18,808,741 N111K possibly damaging Het
Cfap61 T A 2: 145,963,443 S154T probably benign Het
Cyp2c37 T A 19: 39,994,098 S127T probably benign Het
Cyp4f40 T A 17: 32,673,939 D309E probably benign Het
D6Ertd527e A G 6: 87,111,353 D166G unknown Het
Dmbt1 T A 7: 131,050,214 D395E probably damaging Het
Dnah5 A G 15: 28,370,409 S2832G probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fah T C 7: 84,593,212 D296G probably damaging Het
Fam83g A G 11: 61,702,678 N346S probably damaging Het
Fgl1 T A 8: 41,191,601 T289S possibly damaging Het
Fmo1 A C 1: 162,833,862 L284R probably damaging Het
Frem3 T A 8: 80,668,801 M1819K probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Fut1 T C 7: 45,619,428 W269R probably damaging Het
Ggnbp2 A G 11: 84,833,129 Y638H probably damaging Het
Gp2 T A 7: 119,451,630 I293F probably benign Het
Gpi1 T C 7: 34,230,155 N20S probably benign Het
Gxylt1 C T 15: 93,254,392 R222H probably damaging Het
Hemgn T C 4: 46,396,091 K382E possibly damaging Het
Hook3 T A 8: 26,038,106 E585D probably damaging Het
Irf6 G A 1: 193,169,305 M401I probably benign Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Lactb T A 9: 66,970,919 R209S probably damaging Het
Lonp2 A G 8: 86,641,584 D342G probably damaging Het
Mmachc T C 4: 116,705,997 S54G probably damaging Het
Mpp7 C A 18: 7,350,977 W573C probably damaging Het
Olfr1133 T A 2: 87,645,838 Y95F probably benign Het
Olfr1415 A T 1: 92,490,888 I289N probably damaging Het
Olfr70 T A 4: 43,697,011 H54L possibly damaging Het
Pcdh12 A T 18: 38,283,443 F210I probably damaging Het
Ppp1r12c A G 7: 4,484,444 probably null Het
Prkce T A 17: 86,496,018 D448E possibly damaging Het
Ptprb C A 10: 116,339,679 T1193K probably damaging Het
Qrfpr T A 3: 36,182,660 E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 C625S probably benign Het
Shcbp1 T G 8: 4,741,968 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag5 T A 11: 78,305,317 C449* probably null Het
Stpg3 T C 2: 25,213,850 D158G probably damaging Het
Sycp2 T C 2: 178,347,797 Y1423C probably benign Het
Tiprl C T 1: 165,215,790 E256K possibly damaging Het
Tmem132c T A 5: 127,563,567 V934D probably damaging Het
Topors A G 4: 40,261,982 V434A probably benign Het
Usp11 A G X: 20,718,707 Y731C probably damaging Het
Vmn2r58 T A 7: 41,863,963 I419L probably benign Het
Wfs1 C A 5: 36,982,078 R72L possibly damaging Het
Zan T C 5: 137,427,939 D2525G unknown Het
Zfp280c A G X: 48,563,838 V285A probably benign Het
Zfp511 T A 7: 140,037,615 F177I probably damaging Het
Zfp964 A G 8: 69,663,070 M107V unknown Het
Zmynd11 A G 13: 9,710,220 Y122H probably damaging Het
Other mutations in Pappa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Pappa2 APN 1 158857148 missense probably damaging 1.00
IGL01394:Pappa2 APN 1 158765104 splice site probably benign
IGL01570:Pappa2 APN 1 158814540 nonsense probably null
IGL01618:Pappa2 APN 1 158857378 missense probably damaging 1.00
IGL01717:Pappa2 APN 1 158857132 critical splice donor site probably null
IGL01804:Pappa2 APN 1 158936519 missense probably benign
IGL01904:Pappa2 APN 1 158783941 missense probably damaging 0.99
IGL02116:Pappa2 APN 1 158845125 missense probably benign 0.01
IGL02174:Pappa2 APN 1 158761618 missense probably damaging 1.00
IGL02302:Pappa2 APN 1 158715001 missense probably benign 0.38
IGL02422:Pappa2 APN 1 158936933 missense probably damaging 1.00
IGL02572:Pappa2 APN 1 158851216 missense probably benign
IGL02659:Pappa2 APN 1 158936794 missense probably damaging 0.97
IGL02887:Pappa2 APN 1 158782259 missense probably damaging 1.00
IGL02981:Pappa2 APN 1 158851144 missense probably benign 0.00
IGL03128:Pappa2 APN 1 158936484 missense probably benign 0.16
IGL03142:Pappa2 APN 1 158854931 missense probably damaging 1.00
IGL03270:Pappa2 APN 1 158765067 missense possibly damaging 0.78
Gulliver UTSW 1 158857136 missense probably null 1.00
Lilliputian UTSW 1 158716990 missense probably damaging 1.00
Lilliputian2 UTSW 1 158834918 nonsense probably null
lilliputian3 UTSW 1 158782403 splice site probably null
Pitzel UTSW 1 158956645 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0106:Pappa2 UTSW 1 158714977 missense probably damaging 1.00
R0172:Pappa2 UTSW 1 158854849 critical splice donor site probably null
R0194:Pappa2 UTSW 1 158765101 splice site probably benign
R0418:Pappa2 UTSW 1 158716990 missense probably damaging 1.00
R0421:Pappa2 UTSW 1 158848080 missense probably damaging 1.00
R0441:Pappa2 UTSW 1 158763058 unclassified probably benign
R0602:Pappa2 UTSW 1 158763055 unclassified probably benign
R0630:Pappa2 UTSW 1 158832773 missense probably benign
R0760:Pappa2 UTSW 1 158716961 critical splice donor site probably null
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1146:Pappa2 UTSW 1 158854982 missense probably damaging 1.00
R1243:Pappa2 UTSW 1 158845100 missense probably damaging 1.00
R1502:Pappa2 UTSW 1 158957288 missense probably damaging 1.00
R1599:Pappa2 UTSW 1 158857172 missense probably damaging 1.00
R1689:Pappa2 UTSW 1 158957398 missense probably damaging 1.00
R1750:Pappa2 UTSW 1 158763150 nonsense probably null
R1772:Pappa2 UTSW 1 158814368 missense possibly damaging 0.92
R1832:Pappa2 UTSW 1 158857316 missense probably damaging 1.00
R1905:Pappa2 UTSW 1 158803503 splice site probably null
R1914:Pappa2 UTSW 1 158750563 missense probably damaging 0.97
R2013:Pappa2 UTSW 1 158834928 missense probably damaging 1.00
R2037:Pappa2 UTSW 1 158956644 nonsense probably null
R2118:Pappa2 UTSW 1 158857266 missense probably damaging 1.00
R2268:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2269:Pappa2 UTSW 1 158857271 missense probably damaging 1.00
R2347:Pappa2 UTSW 1 158765043 missense probably damaging 1.00
R3024:Pappa2 UTSW 1 158936225 missense probably benign 0.00
R3706:Pappa2 UTSW 1 158834918 nonsense probably null
R3707:Pappa2 UTSW 1 158834918 nonsense probably null
R3708:Pappa2 UTSW 1 158834918 nonsense probably null
R4600:Pappa2 UTSW 1 158814445 missense probably damaging 1.00
R4737:Pappa2 UTSW 1 158957012 missense probably benign
R4738:Pappa2 UTSW 1 158957012 missense probably benign
R4739:Pappa2 UTSW 1 158957002 missense probably damaging 0.99
R4739:Pappa2 UTSW 1 158957012 missense probably benign
R4788:Pappa2 UTSW 1 158783917 missense possibly damaging 0.86
R4798:Pappa2 UTSW 1 158857379 missense probably damaging 0.99
R4952:Pappa2 UTSW 1 158857136 missense probably null 1.00
R5121:Pappa2 UTSW 1 158838627 missense probably benign 0.01
R5144:Pappa2 UTSW 1 158957133 missense probably benign 0.03
R5159:Pappa2 UTSW 1 158761619 missense probably damaging 1.00
R5278:Pappa2 UTSW 1 158782403 splice site probably null
R5428:Pappa2 UTSW 1 158814785 missense possibly damaging 0.53
R5452:Pappa2 UTSW 1 158838602 missense probably benign 0.00
R5477:Pappa2 UTSW 1 158956738 missense probably benign 0.00
R5504:Pappa2 UTSW 1 158848045 missense probably benign 0.00
R5852:Pappa2 UTSW 1 158717014 missense probably damaging 1.00
R6003:Pappa2 UTSW 1 158936250 missense probably benign 0.23
R6129:Pappa2 UTSW 1 158714997 nonsense probably null
R6137:Pappa2 UTSW 1 158871543 missense probably damaging 1.00
R6374:Pappa2 UTSW 1 158956645 missense probably damaging 1.00
R6472:Pappa2 UTSW 1 158834799 missense probably damaging 1.00
R6804:Pappa2 UTSW 1 158936868 missense probably benign 0.24
X0058:Pappa2 UTSW 1 158814397 missense probably null
X0061:Pappa2 UTSW 1 158936618 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ACCTGGTAGCGGATCACTTTCTCTC -3'
(R):5'- CAGCCACTTACGATGGACAGCATAC -3'

Sequencing Primer
(F):5'- ACTTTCTCTCTACGAAGGGGC -3'
(R):5'- GTTTGGACCGCTAAATAGCC -3'
Posted On2014-03-14