Incidental Mutation 'R1414:Myh3'
ID159749
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Namemyosin, heavy polypeptide 3, skeletal muscle, embryonic
SynonymsMyhse, Myhs-e, MyHC-emb
MMRRC Submission 039470-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R1414 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67078300-67102291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67098665 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1537 (E1537G)
Ref Sequence ENSEMBL: ENSMUSP00000131883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
Predicted Effect probably damaging
Transcript: ENSMUST00000007301
AA Change: E1537G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: E1537G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108689
AA Change: E1537G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: E1537G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165221
AA Change: E1537G

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: E1537G

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184592
Meta Mutation Damage Score 0.422 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap1 T A 15: 64,158,884 S315C possibly damaging Het
Cdc27 A G 11: 104,521,425 V452A probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dnajc10 C A 2: 80,347,677 T676K probably damaging Het
Efhc1 C T 1: 20,961,289 T237I probably damaging Het
Fam19a4 A G 6: 97,014,479 V3A probably benign Het
Fn1 A G 1: 71,601,303 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hfm1 T C 5: 106,872,353 D1069G probably benign Het
Hspa9 T C 18: 34,938,591 Y652C probably damaging Het
Lrfn2 A G 17: 49,070,829 I313V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mxra8 A G 4: 155,841,007 M58V probably damaging Het
Nlrp3 A G 11: 59,549,531 M645V probably benign Het
Nlrp4d T A 7: 10,382,601 I118F probably benign Het
Oas1f A G 5: 120,851,459 probably benign Het
Pkp1 A G 1: 135,884,085 probably benign Het
Plcb3 T C 19: 6,963,017 Y428C probably damaging Het
Pomt1 C A 2: 32,243,610 probably benign Het
Prex1 G A 2: 166,593,861 R589C probably damaging Het
Prr5 C T 15: 84,699,711 Q171* probably null Het
Ptar1 T A 19: 23,720,291 L389Q possibly damaging Het
Rufy2 T A 10: 63,002,199 L375* probably null Het
Slc22a1 G A 17: 12,662,600 S334L probably damaging Het
Slc34a1 T C 13: 55,400,711 S45P probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tnc A G 4: 63,965,695 probably benign Het
Tpm3-rs7 T C 14: 113,314,842 I56T possibly damaging Het
Zbtb11 T A 16: 55,990,560 C360* probably null Het
Zfp263 T C 16: 3,749,296 C204R probably damaging Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0266:Myh3 UTSW 11 67093672 missense possibly damaging 0.73
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 intron probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R1923:Myh3 UTSW 11 67080002 missense probably benign 0.00
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R4946:Myh3 UTSW 11 67093538 missense probably benign
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6223:Myh3 UTSW 11 67098017 missense probably benign
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGGGTCTGCTGATGCACCAATAG -3'
(R):5'- ACTCAGGCACACAGTCATAGGGAAG -3'

Sequencing Primer
(F):5'- acgttctcttcagacacacc -3'
(R):5'- CACAGTCATAGGGAAGGAGCG -3'
Posted On2014-03-14