Incidental Mutation 'R1415:Gm38394'
ID159763
Institutional Source Beutler Lab
Gene Symbol Gm38394
Ensembl Gene ENSMUSG00000094410
Gene Namepredicted gene, 38394
Synonyms
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location133619940-133661318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 133657818 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 594 (V594M)
Ref Sequence ENSEMBL: ENSMUSP00000140892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027736] [ENSMUST00000179598] [ENSMUST00000186476] [ENSMUST00000190574] [ENSMUST00000191896] [ENSMUST00000193504] [ENSMUST00000194668] [ENSMUST00000195067] [ENSMUST00000195424]
Predicted Effect probably benign
Transcript: ENSMUST00000027736
SMART Domains Protein: ENSMUSP00000027736
Gene: ENSMUSG00000116275

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179598
AA Change: V594M

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136026
Gene: ENSMUSG00000094410
AA Change: V594M

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 9.3e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186476
AA Change: V594M

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139417
Gene: ENSMUSG00000094410
AA Change: V594M

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190574
AA Change: V594M

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140892
Gene: ENSMUSG00000102049
AA Change: V594M

DomainStartEndE-ValueType
low complexity region 57 84 N/A INTRINSIC
ZnF_BED 130 183 1.42e-8 SMART
low complexity region 203 215 N/A INTRINSIC
ZnF_BED 265 318 5.37e-9 SMART
low complexity region 840 862 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 869 950 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191705
Predicted Effect probably benign
Transcript: ENSMUST00000191896
SMART Domains Protein: ENSMUSP00000141255
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 4.26e-1 SMART
ZnF_C3H1 31 56 7.62e0 SMART
ZnF_C3H1 60 86 6.83e1 SMART
low complexity region 161 176 N/A INTRINSIC
low complexity region 218 241 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 625 647 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
low complexity region 770 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192775
Predicted Effect probably benign
Transcript: ENSMUST00000193504
SMART Domains Protein: ENSMUSP00000141895
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
Blast:ZnF_C3H1 60 84 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194668
SMART Domains Protein: ENSMUSP00000141727
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195067
Predicted Effect probably benign
Transcript: ENSMUST00000195424
SMART Domains Protein: ENSMUSP00000142066
Gene: ENSMUSG00000102976

DomainStartEndE-ValueType
ZnF_C3H1 3 28 1.8e-3 SMART
ZnF_C3H1 31 56 3.2e-2 SMART
ZnF_C3H1 60 86 2.9e-1 SMART
low complexity region 161 176 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Gm38394
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0385:Gm38394 UTSW 1 133656784 missense probably damaging 0.99
R0417:Gm38394 UTSW 1 133658538 missense probably benign
R0526:Gm38394 UTSW 1 133658734 missense probably damaging 0.99
R0576:Gm38394 UTSW 1 133657838 missense probably benign 0.37
R1164:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1187:Gm38394 UTSW 1 133659203 missense probably damaging 1.00
R1997:Gm38394 UTSW 1 133656713 missense probably damaging 1.00
R2186:Gm38394 UTSW 1 133658079 missense probably damaging 1.00
R2875:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2876:Gm38394 UTSW 1 133656860 missense probably damaging 1.00
R2975:Gm38394 UTSW 1 133658237 missense probably damaging 0.99
R4573:Gm38394 UTSW 1 133659389 missense probably benign 0.00
R4631:Gm38394 UTSW 1 133658744 missense probably damaging 1.00
R4671:Gm38394 UTSW 1 133657040 missense probably benign
R4976:Gm38394 UTSW 1 133658094 missense probably benign 0.27
R5048:Gm38394 UTSW 1 133658724 missense probably damaging 0.99
R5318:Gm38394 UTSW 1 133658115 missense possibly damaging 0.86
R5400:Gm38394 UTSW 1 133658141 missense probably damaging 1.00
R5427:Gm38394 UTSW 1 133657595 missense possibly damaging 0.83
R6530:Gm38394 UTSW 1 133659201 missense probably damaging 1.00
R7511:Gm38394 UTSW 1 133659243 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGAGGGCCTGAGTAATACCTCTGAC -3'
(R):5'- TGGACTCATGACCCTTCCACTGAC -3'

Sequencing Primer
(F):5'- GTAAGTACAACTCCACTGGCTCTG -3'
(R):5'- ACACTGGGTCTCTTTGGAAAC -3'
Posted On2014-03-14