Incidental Mutation 'R1415:Secisbp2l'
ID159766
Institutional Source Beutler Lab
Gene Symbol Secisbp2l
Ensembl Gene ENSMUSG00000035093
Gene NameSECIS binding protein 2-like
Synonyms3110001I20Rik
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125736986-125782870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 125740365 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 1057 (G1057V)
Ref Sequence ENSEMBL: ENSMUSP00000055772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053699]
Predicted Effect probably benign
Transcript: ENSMUST00000053699
AA Change: G1057V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: G1057V

DomainStartEndE-ValueType
low complexity region 441 459 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 700 802 7.6e-24 PFAM
low complexity region 821 831 N/A INTRINSIC
low complexity region 970 978 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139944
SMART Domains Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 326 427 3.5e-24 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Secisbp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Secisbp2l APN 2 125743856 missense probably damaging 0.99
IGL00644:Secisbp2l APN 2 125743844 missense probably damaging 1.00
IGL01093:Secisbp2l APN 2 125740325 missense probably benign
IGL01621:Secisbp2l APN 2 125773211 missense probably benign
IGL01955:Secisbp2l APN 2 125743812 critical splice donor site probably null
IGL02036:Secisbp2l APN 2 125758207 missense probably benign
IGL02045:Secisbp2l APN 2 125775578 missense possibly damaging 0.82
IGL02182:Secisbp2l APN 2 125747577 missense probably damaging 1.00
IGL02408:Secisbp2l APN 2 125740869 nonsense probably null
IGL02455:Secisbp2l APN 2 125773478 missense possibly damaging 0.89
IGL02953:Secisbp2l APN 2 125760274 missense probably benign 0.36
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R1626:Secisbp2l UTSW 2 125775686 missense probably damaging 0.99
R1926:Secisbp2l UTSW 2 125740677 missense probably damaging 0.99
R1940:Secisbp2l UTSW 2 125740339 missense probably damaging 1.00
R1970:Secisbp2l UTSW 2 125747510 missense probably damaging 1.00
R2100:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2240:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2252:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2253:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2472:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2474:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2475:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2990:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2993:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3113:Secisbp2l UTSW 2 125750286 missense probably damaging 1.00
R3696:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3750:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3800:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3810:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3812:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3815:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3816:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3817:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3880:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4077:Secisbp2l UTSW 2 125751865 splice site probably benign
R4096:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4097:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4164:Secisbp2l UTSW 2 125751883 intron probably benign
R4332:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4418:Secisbp2l UTSW 2 125752915 missense probably benign 0.00
R4598:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4600:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4602:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4603:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4678:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4679:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4684:Secisbp2l UTSW 2 125745942 missense probably damaging 1.00
R4741:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4934:Secisbp2l UTSW 2 125740489 missense probably damaging 0.99
R5245:Secisbp2l UTSW 2 125747591 missense probably damaging 1.00
R5521:Secisbp2l UTSW 2 125752977 missense possibly damaging 0.94
R5547:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5630:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5631:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5632:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6378:Secisbp2l UTSW 2 125768325 missense possibly damaging 0.78
R6616:Secisbp2l UTSW 2 125768226 missense probably damaging 0.96
R6938:Secisbp2l UTSW 2 125750352 missense probably damaging 1.00
R7287:Secisbp2l UTSW 2 125740369 missense probably benign
R7373:Secisbp2l UTSW 2 125757271 missense probably damaging 0.99
R7403:Secisbp2l UTSW 2 125760279 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGTACATGGCTGCATCTGGACAC -3'
(R):5'- AGCTGCCGGGATCTTTTGAACTC -3'

Sequencing Primer
(F):5'- GGTGCTCTTTGCCCATGTTA -3'
(R):5'- gaagaggaggaggaggagg -3'
Posted On2014-03-14