Incidental Mutation 'R1415:Gigyf1'
ID159772
Institutional Source Beutler Lab
Gene Symbol Gigyf1
Ensembl Gene ENSMUSG00000029714
Gene NameGRB10 interacting GYF protein 1
SynonymsPerq1
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137518548-137527935 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 137519216 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031727] [ENSMUST00000111038] [ENSMUST00000197624]
Predicted Effect probably null
Transcript: ENSMUST00000031727
SMART Domains Protein: ENSMUSP00000031727
Gene: ENSMUSG00000029714

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 323 352 N/A INTRINSIC
low complexity region 360 379 N/A INTRINSIC
coiled coil region 424 450 N/A INTRINSIC
GYF 477 532 1.6e-25 SMART
low complexity region 534 543 N/A INTRINSIC
low complexity region 553 576 N/A INTRINSIC
low complexity region 597 613 N/A INTRINSIC
coiled coil region 671 735 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
low complexity region 848 877 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
coiled coil region 957 984 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111038
SMART Domains Protein: ENSMUSP00000106667
Gene: ENSMUSG00000029711

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EPO_TPO 30 191 2.8e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197624
SMART Domains Protein: ENSMUSP00000143670
Gene: ENSMUSG00000029714

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197762
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Gigyf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gigyf1 APN 5 137522745 unclassified probably benign
IGL00326:Gigyf1 APN 5 137518948 utr 5 prime probably benign
IGL00935:Gigyf1 APN 5 137524834 missense possibly damaging 0.95
IGL01717:Gigyf1 APN 5 137525691 missense probably damaging 1.00
IGL02090:Gigyf1 APN 5 137525564 splice site probably null
IGL02354:Gigyf1 APN 5 137519727 splice site probably benign
IGL02361:Gigyf1 APN 5 137519727 splice site probably benign
IGL03370:Gigyf1 APN 5 137525690 missense possibly damaging 0.93
PIT4354001:Gigyf1 UTSW 5 137524104 missense unknown
R1764:Gigyf1 UTSW 5 137522508 unclassified probably benign
R2259:Gigyf1 UTSW 5 137520332 missense possibly damaging 0.93
R2260:Gigyf1 UTSW 5 137520332 missense possibly damaging 0.93
R4656:Gigyf1 UTSW 5 137525215 nonsense probably null
R4717:Gigyf1 UTSW 5 137525232 missense probably damaging 1.00
R4732:Gigyf1 UTSW 5 137524770 missense probably benign 0.39
R4733:Gigyf1 UTSW 5 137524770 missense probably benign 0.39
R4942:Gigyf1 UTSW 5 137525690 missense possibly damaging 0.93
R5338:Gigyf1 UTSW 5 137523160 unclassified probably benign
R5503:Gigyf1 UTSW 5 137523467 unclassified probably benign
R5790:Gigyf1 UTSW 5 137524255 unclassified probably benign
R5888:Gigyf1 UTSW 5 137525697 missense probably damaging 1.00
R5955:Gigyf1 UTSW 5 137523507 splice site probably null
R6544:Gigyf1 UTSW 5 137525059 missense probably damaging 1.00
R7227:Gigyf1 UTSW 5 137523823 missense unknown
R7493:Gigyf1 UTSW 5 137525533 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTTGAGAAGCATCGAAGCTCCAC -3'
(R):5'- TGCAGCGGTTCCTCTTGTAACAC -3'

Sequencing Primer
(F):5'- AGAGACACTCAACTTTGGGC -3'
(R):5'- ACTCAGAGGCAACTCACAGA -3'
Posted On2014-03-14