Incidental Mutation 'R1415:Olfr667'
ID159774
Institutional Source Beutler Lab
Gene Symbol Olfr667
Ensembl Gene ENSMUSG00000056782
Gene Nameolfactory receptor 667
SynonymsGA_x6K02T2PBJ9-7546146-7545166, MOR34-2, MOR34-11
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104914742-104921482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104916336 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 320 (I320T)
Ref Sequence ENSEMBL: ENSMUSP00000150340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071362] [ENSMUST00000217177]
Predicted Effect probably benign
Transcript: ENSMUST00000071362
AA Change: I320T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100470
Gene: ENSMUSG00000056782
AA Change: I320T

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 4.9e-102 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.2e-8 PFAM
Pfam:7tm_1 43 295 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211111
Predicted Effect probably benign
Transcript: ENSMUST00000217177
AA Change: I320T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Olfr667
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02707:Olfr667 APN 7 104916652 missense probably damaging 1.00
R0457:Olfr667 UTSW 7 104916973 missense probably benign 0.19
R0684:Olfr667 UTSW 7 104916634 missense probably benign 0.21
R1343:Olfr667 UTSW 7 104916627 missense probably damaging 1.00
R1401:Olfr667 UTSW 7 104916756 missense probably damaging 1.00
R1644:Olfr667 UTSW 7 104916808 missense probably benign 0.02
R1907:Olfr667 UTSW 7 104917065 missense probably damaging 0.99
R2063:Olfr667 UTSW 7 104916775 missense probably benign 0.02
R3774:Olfr667 UTSW 7 104916906 missense probably benign 0.01
R4751:Olfr667 UTSW 7 104916410 nonsense probably null
R4958:Olfr667 UTSW 7 104916461 missense probably damaging 0.97
R4960:Olfr667 UTSW 7 104916708 missense probably benign 0.02
R5362:Olfr667 UTSW 7 104916627 missense probably damaging 1.00
R5988:Olfr667 UTSW 7 104916918 missense probably damaging 0.98
R7396:Olfr667 UTSW 7 104916351 missense probably benign
Z1088:Olfr667 UTSW 7 104916666 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AAGCTCTTAGACACTTTTCTGTGCGAA -3'
(R):5'- ACCTGCACATCTCACATCTGTGCTA -3'

Sequencing Primer
(F):5'- GACACTTGGCCCAATTGTTATCATAG -3'
(R):5'- TTTAATTTCTTCACTCATCGTTTTGG -3'
Posted On2014-03-14