Incidental Mutation 'R1421:Gm28042'
ID159804
Institutional Source Beutler Lab
Gene Symbol Gm28042
Ensembl Gene ENSMUSG00000033852
Gene Namepredicted gene, 28042
Synonyms
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location120027493-120043033 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120036463 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 196 (S196T)
Ref Sequence ENSEMBL: ENSMUSP00000118458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044675] [ENSMUST00000126150] [ENSMUST00000129685] [ENSMUST00000156805] [ENSMUST00000162393]
Predicted Effect probably benign
Transcript: ENSMUST00000044675
SMART Domains Protein: ENSMUSP00000041220
Gene: ENSMUSG00000098789

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 307 4.31e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125805
SMART Domains Protein: ENSMUSP00000122869
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
Pfam:Cupin_8 2 62 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126150
AA Change: S196T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488
AA Change: S196T

DomainStartEndE-ValueType
C2 19 119 1.79e-17 SMART
PLAc 233 789 1.99e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129685
AA Change: S419T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852
AA Change: S419T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153571
Predicted Effect probably benign
Transcript: ENSMUST00000156805
AA Change: S419T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852
AA Change: S419T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Meta Mutation Damage Score 0.1596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This locus represents naturally-occurring readthrough transcription between the neighboring Jmjd7 (jumonji domain containing 7) and Pla2g4b (phospholipase A2, group IVB (cytosolic)) genes on chromosome 2. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Gm28042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Gm28042 APN 2 120030356 missense probably damaging 1.00
IGL01148:Gm28042 APN 2 120039038 missense possibly damaging 0.74
IGL02005:Gm28042 APN 2 120034634 missense possibly damaging 0.95
IGL02237:Gm28042 APN 2 120039899 missense possibly damaging 0.61
IGL02539:Gm28042 APN 2 120035221 missense probably damaging 1.00
IGL02747:Gm28042 APN 2 120031394 missense probably damaging 1.00
IGL02825:Gm28042 APN 2 120031644 missense probably damaging 0.99
IGL02998:Gm28042 APN 2 120040154 missense possibly damaging 0.70
IGL03057:Gm28042 APN 2 120032156 missense probably damaging 1.00
IGL03084:Gm28042 APN 2 120040505 missense probably benign 0.08
IGL03160:Gm28042 APN 2 120035828 missense possibly damaging 0.94
R0147:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R0270:Gm28042 UTSW 2 120041592 missense probably benign 0.06
R0315:Gm28042 UTSW 2 120039057 missense probably damaging 1.00
R1589:Gm28042 UTSW 2 120041406 missense probably benign 0.05
R1599:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R1656:Gm28042 UTSW 2 120038889 missense probably damaging 1.00
R1718:Gm28042 UTSW 2 120036391 missense possibly damaging 0.78
R1969:Gm28042 UTSW 2 120041615 makesense probably null
R2164:Gm28042 UTSW 2 120036748 missense probably benign 0.01
R2275:Gm28042 UTSW 2 120036829 missense probably damaging 1.00
R3976:Gm28042 UTSW 2 120036756 missense probably benign 0.11
R4483:Gm28042 UTSW 2 120035840 missense possibly damaging 0.68
R4614:Gm28042 UTSW 2 120041158 missense probably damaging 0.99
R4802:Gm28042 UTSW 2 120042054 utr 3 prime probably benign
R4976:Gm28042 UTSW 2 120034643 missense probably damaging 1.00
R5119:Gm28042 UTSW 2 120034643 missense probably damaging 1.00
R5177:Gm28042 UTSW 2 120041601 unclassified probably null
R5340:Gm28042 UTSW 2 120041448 missense probably benign
R5861:Gm28042 UTSW 2 120034635 missense probably damaging 1.00
R6641:Gm28042 UTSW 2 120039683 missense probably damaging 1.00
X0019:Gm28042 UTSW 2 120039658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCATGTCAGAGACGATTTCCC -3'
(R):5'- GAGAAAGGACCCTGCGAGTCATTAC -3'

Sequencing Primer
(F):5'- GTCAGAGCGCAAAGTTCAAC -3'
(R):5'- TAACTCCCTGTGGCAAGGAC -3'
Posted On2014-03-14