Incidental Mutation 'R1421:Lrrc4b'
ID159813
Institutional Source Beutler Lab
Gene Symbol Lrrc4b
Ensembl Gene ENSMUSG00000047085
Gene Nameleucine rich repeat containing 4B
SynonymsLrig4
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R1421 (G1)
Quality Score109
Status Validated
Chromosome7
Chromosomal Location44429018-44463351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44461051 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 116 (I116V)
Ref Sequence ENSEMBL: ENSMUSP00000123389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035929] [ENSMUST00000058667] [ENSMUST00000127790] [ENSMUST00000135624] [ENSMUST00000146128] [ENSMUST00000152902] [ENSMUST00000156093]
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058667
AA Change: I116V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000053123
Gene: ENSMUSG00000047085
AA Change: I116V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
LRR 208 229 1.62e2 SMART
LRR_TYP 230 253 3.63e-3 SMART
LRR 254 277 9.75e0 SMART
LRR_TYP 278 301 5.29e-5 SMART
LRRCT 313 364 1.92e-3 SMART
IGc2 378 445 1.45e-9 SMART
low complexity region 462 482 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 624 644 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127790
AA Change: I116V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123389
Gene: ENSMUSG00000047085
AA Change: I116V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Predicted Effect probably benign
Transcript: ENSMUST00000156093
AA Change: I116V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119374
Gene: ENSMUSG00000047085
AA Change: I116V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
LRR 208 230 3.65e1 SMART
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Lrrc4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Lrrc4b UTSW 7 44462315 missense probably damaging 0.99
R1398:Lrrc4b UTSW 7 44462452 missense probably benign 0.44
R1622:Lrrc4b UTSW 7 44462230 unclassified probably benign
R1681:Lrrc4b UTSW 7 44461177 missense probably damaging 0.99
R1778:Lrrc4b UTSW 7 44462399 missense probably benign
R1967:Lrrc4b UTSW 7 44462230 unclassified probably benign
R1989:Lrrc4b UTSW 7 44462230 unclassified probably benign
R2427:Lrrc4b UTSW 7 44462552 missense probably damaging 1.00
R3820:Lrrc4b UTSW 7 44462558 missense probably damaging 1.00
R3822:Lrrc4b UTSW 7 44462558 missense probably damaging 1.00
R4774:Lrrc4b UTSW 7 44462372 unclassified probably null
R5249:Lrrc4b UTSW 7 44462564 missense possibly damaging 0.93
R5268:Lrrc4b UTSW 7 44461363 missense probably damaging 1.00
R6029:Lrrc4b UTSW 7 44462330 missense probably benign 0.00
R6984:Lrrc4b UTSW 7 44461298 missense possibly damaging 0.62
R7003:Lrrc4b UTSW 7 44445156 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCCACGTAGTGAGCCTCCTC -3'
(R):5'- CCGCCTCAGATATGTACTCCAGCC -3'

Sequencing Primer
(F):5'- tgggaatgaaggataatggtagag -3'
(R):5'- AGATATGTACTCCAGCCTCTTCAG -3'
Posted On2014-03-14