Incidental Mutation 'R1421:Tnnt3'
ID159817
Institutional Source Beutler Lab
Gene Symbol Tnnt3
Ensembl Gene ENSMUSG00000061723
Gene Nametroponin T3, skeletal, fast
SynonymsfTnT, skeletal muscle fast-twitch TnT
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location142498836-142516009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142511366 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 108 (E108G)
Ref Sequence ENSEMBL: ENSMUSP00000137111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074187] [ENSMUST00000078497] [ENSMUST00000105941] [ENSMUST00000105942] [ENSMUST00000105943] [ENSMUST00000105944] [ENSMUST00000105945] [ENSMUST00000105946] [ENSMUST00000105947] [ENSMUST00000105948] [ENSMUST00000105949] [ENSMUST00000105950] [ENSMUST00000105952] [ENSMUST00000105953] [ENSMUST00000105954] [ENSMUST00000105955] [ENSMUST00000105957] [ENSMUST00000105958] [ENSMUST00000128294] [ENSMUST00000146804] [ENSMUST00000169299] [ENSMUST00000179658] [ENSMUST00000180152]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000054910
SMART Domains Protein: ENSMUSP00000061994
Gene: ENSMUSG00000043795

DomainStartEndE-ValueType
Pfam:DUF4643 6 259 1.3e-108 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000074187
AA Change: E84G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073815
Gene: ENSMUSG00000061723
AA Change: E84G

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078497
AA Change: E104G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077587
Gene: ENSMUSG00000061723
AA Change: E104G

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
Pfam:Troponin 72 214 2.1e-42 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105941
AA Change: E84G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101561
Gene: ENSMUSG00000061723
AA Change: E84G

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 2.1e-42 PFAM
low complexity region 229 245 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105942
AA Change: E75G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101562
Gene: ENSMUSG00000061723
AA Change: E75G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.7e-42 PFAM
low complexity region 224 236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105943
AA Change: E75G

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101563
Gene: ENSMUSG00000061723
AA Change: E75G

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.9e-42 PFAM
low complexity region 220 236 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105944
AA Change: E86G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101564
Gene: ENSMUSG00000061723
AA Change: E86G

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2e-42 PFAM
low complexity region 235 247 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105945
AA Change: E84G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101565
Gene: ENSMUSG00000061723
AA Change: E84G

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105946
AA Change: E90G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101566
Gene: ENSMUSG00000061723
AA Change: E90G

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105947
AA Change: E95G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101567
Gene: ENSMUSG00000061723
AA Change: E95G

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.9e-42 PFAM
low complexity region 240 256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105948
AA Change: E86G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101568
Gene: ENSMUSG00000061723
AA Change: E86G

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2.2e-42 PFAM
low complexity region 231 247 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105949
AA Change: E80G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101569
Gene: ENSMUSG00000061723
AA Change: E80G

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:Troponin 48 190 1.8e-42 PFAM
low complexity region 229 241 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105950
AA Change: E98G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101570
Gene: ENSMUSG00000061723
AA Change: E98G

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
internal_repeat_1 213 240 4.67e-5 PROSPERO
low complexity region 247 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105952
AA Change: E95G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101572
Gene: ENSMUSG00000061723
AA Change: E95G

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105953
AA Change: E98G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101573
Gene: ENSMUSG00000061723
AA Change: E98G

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105954
AA Change: E99G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101574
Gene: ENSMUSG00000061723
AA Change: E99G

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Troponin 67 209 1.9e-42 PFAM
low complexity region 248 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105955
AA Change: E91G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101575
Gene: ENSMUSG00000061723
AA Change: E91G

DomainStartEndE-ValueType
coiled coil region 1 36 N/A INTRINSIC
Pfam:Troponin 59 201 2.2e-42 PFAM
low complexity region 240 252 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105957
AA Change: E95G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101577
Gene: ENSMUSG00000061723
AA Change: E95G

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105958
AA Change: E108G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101578
Gene: ENSMUSG00000061723
AA Change: E108G

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 2.1e-42 PFAM
low complexity region 253 269 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125649
Predicted Effect unknown
Transcript: ENSMUST00000128294
AA Change: E81G
SMART Domains Protein: ENSMUSP00000116223
Gene: ENSMUSG00000061723
AA Change: E81G

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Troponin 49 107 3.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144259
Predicted Effect possibly damaging
Transcript: ENSMUST00000146804
AA Change: E81G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116087
Gene: ENSMUSG00000061723
AA Change: E81G

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Troponin 49 191 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153262
Predicted Effect possibly damaging
Transcript: ENSMUST00000169299
AA Change: E90G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127854
Gene: ENSMUSG00000061723
AA Change: E90G

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179658
AA Change: E108G

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136278
Gene: ENSMUSG00000061723
AA Change: E108G

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 212 1.5e-36 PFAM
low complexity region 257 269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180152
AA Change: E108G

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137111
Gene: ENSMUSG00000061723
AA Change: E108G

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 5.1e-42 PFAM
internal_repeat_1 223 250 2.76e-5 PROSPERO
low complexity region 257 269 N/A INTRINSIC
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, liver and kidney hemorrhage and thin diaphragm. Mice heterozygous for this allele exhibit growth retardation with mild skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Tnnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Tnnt3 APN 7 142508325 intron probably benign
IGL02376:Tnnt3 APN 7 142512558 missense possibly damaging 0.64
R0432:Tnnt3 UTSW 7 142512086 missense probably benign 0.09
R0463:Tnnt3 UTSW 7 142512335 missense probably benign 0.25
R1521:Tnnt3 UTSW 7 142515825 nonsense probably null
R1789:Tnnt3 UTSW 7 142512364 missense probably damaging 1.00
R1990:Tnnt3 UTSW 7 142511525 missense possibly damaging 0.78
R1991:Tnnt3 UTSW 7 142511525 missense possibly damaging 0.78
R2029:Tnnt3 UTSW 7 142512627 splice site probably benign
R2216:Tnnt3 UTSW 7 142512564 missense probably benign 0.03
R4779:Tnnt3 UTSW 7 142514283 intron probably benign
R5568:Tnnt3 UTSW 7 142512040 missense probably damaging 0.98
R5756:Tnnt3 UTSW 7 142502758 critical splice donor site probably null
R5994:Tnnt3 UTSW 7 142511266 missense probably damaging 1.00
R6265:Tnnt3 UTSW 7 142501645 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGCCAGGTCACCTCAAGAATG -3'
(R):5'- AACAGGAAGGCACAGTCCTTACCG -3'

Sequencing Primer
(F):5'- ACCTCAAGAATGGTACTGGCTTC -3'
(R):5'- ACCGCCAATCTGTTCTGG -3'
Posted On2014-03-14