Incidental Mutation 'R1421:Misp'
ID159821
Institutional Source Beutler Lab
Gene Symbol Misp
Ensembl Gene ENSMUSG00000035852
Gene Namemitotic spindle positioning
Synonyms9130017N09Rik
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79820989-79830490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79826847 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 366 (D366G)
Ref Sequence ENSEMBL: ENSMUSP00000151529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046833] [ENSMUST00000169041] [ENSMUST00000218687] [ENSMUST00000219305] [ENSMUST00000219734]
Predicted Effect probably damaging
Transcript: ENSMUST00000046833
AA Change: D366G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048893
Gene: ENSMUSG00000035852
AA Change: D366G

DomainStartEndE-ValueType
low complexity region 262 284 N/A INTRINSIC
Pfam:AKAP2_C 294 643 2.2e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169041
AA Change: D366G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130071
Gene: ENSMUSG00000035852
AA Change: D366G

DomainStartEndE-ValueType
low complexity region 262 284 N/A INTRINSIC
Pfam:AKAP2_C 294 643 1.7e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218531
Predicted Effect probably benign
Transcript: ENSMUST00000218687
Predicted Effect probably damaging
Transcript: ENSMUST00000219305
AA Change: D366G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219734
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin-bundling protein involved in determining cell morphology and mitotic progression. The encoded protein is required for the proper positioning of the mitotic spindle. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Misp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Misp APN 10 79827871 unclassified probably benign
IGL02565:Misp APN 10 79826343 missense probably benign 0.33
IGL02901:Misp APN 10 79826937 missense possibly damaging 0.70
R1118:Misp UTSW 10 79827135 missense probably benign 0.01
R1656:Misp UTSW 10 79825943 missense possibly damaging 0.75
R2864:Misp UTSW 10 79827038 missense probably benign 0.05
R3786:Misp UTSW 10 79825961 missense probably benign 0.23
R5035:Misp UTSW 10 79827956 missense probably benign 0.01
R5503:Misp UTSW 10 79826718 missense probably damaging 1.00
R5594:Misp UTSW 10 79827143 missense probably damaging 1.00
R5982:Misp UTSW 10 79827894 nonsense probably null
R6066:Misp UTSW 10 79826312 missense possibly damaging 0.66
R6236:Misp UTSW 10 79827122 missense probably benign 0.00
R7103:Misp UTSW 10 79827165 missense not run
Predicted Primers PCR Primer
(F):5'- TGAGCTTGACAGAGACACCTCCAC -3'
(R):5'- GGATTCTGAGACATGCCTTGGAGAC -3'

Sequencing Primer
(F):5'- CCTCCACGAAGAGACAGGG -3'
(R):5'- ATGCCTTGGAGACTCCGTG -3'
Posted On2014-03-14