Incidental Mutation 'R1421:Zfp735'
ID159824
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Namezinc finger protein 735
Synonyms1700012C15Rik
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73688778-73713798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73710697 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 156 (L156I)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
Predicted Effect probably benign
Transcript: ENSMUST00000080407
AA Change: L156I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: L156I

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149560
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R1931:Zfp735 UTSW 11 73711851 missense possibly damaging 0.69
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCTTGGAACAAAGTGATGCACTTCTGT -3'
(R):5'- CCCACAACTGCTTCCCATGTGA -3'

Sequencing Primer
(F):5'- CCAAGAAGCTATTACCAAAGGTGTG -3'
(R):5'- GCTTCCCATGTGATATATTCCAAG -3'
Posted On2014-03-14