Incidental Mutation 'R1421:Grhl2'
ID159832
Institutional Source Beutler Lab
Gene Symbol Grhl2
Ensembl Gene ENSMUSG00000022286
Gene Namegrainyhead like transcription factor 2
SynonymsBOM, Tcfcp2l3, grainyheadlike, 0610015A08Rik
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37233036-37363569 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37309716 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 352 (Y352C)
Ref Sequence ENSEMBL: ENSMUSP00000125410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022895] [ENSMUST00000161405]
Predicted Effect probably damaging
Transcript: ENSMUST00000022895
AA Change: Y352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022895
Gene: ENSMUSG00000022286
AA Change: Y352C

DomainStartEndE-ValueType
Pfam:CP2 214 438 8.5e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161405
AA Change: Y352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125410
Gene: ENSMUSG00000022286
AA Change: Y352C

DomainStartEndE-ValueType
Pfam:CP2 209 434 2.1e-79 PFAM
Meta Mutation Damage Score 0.342 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can act as a homodimer or as a heterodimer with either GRHL1 or GRHL3. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal dominant type 28 (DFNA28).[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with cranioschisis, facial cleft, impaired neural fold elevation, and an open posterior neuropore. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Grhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Grhl2 APN 15 37336301 missense probably damaging 1.00
IGL01730:Grhl2 APN 15 37337774 missense probably benign 0.00
IGL02140:Grhl2 APN 15 37270586 splice site probably benign
IGL02307:Grhl2 APN 15 37288288 missense probably damaging 1.00
IGL02375:Grhl2 APN 15 37291577 missense probably damaging 1.00
IGL02508:Grhl2 APN 15 37309765 splice site probably benign
clayton UTSW 15 37291676 splice site probably null
R0462:Grhl2 UTSW 15 37344675 missense probably benign 0.00
R1548:Grhl2 UTSW 15 37336323 missense probably benign 0.32
R1912:Grhl2 UTSW 15 37358407 missense probably damaging 1.00
R1960:Grhl2 UTSW 15 37336314 missense probably damaging 1.00
R3110:Grhl2 UTSW 15 37336347 critical splice donor site probably null
R3112:Grhl2 UTSW 15 37336347 critical splice donor site probably null
R4261:Grhl2 UTSW 15 37360823 missense possibly damaging 0.64
R4830:Grhl2 UTSW 15 37335659 unclassified probably null
R4910:Grhl2 UTSW 15 37291676 splice site probably null
R4929:Grhl2 UTSW 15 37360802 missense probably benign
R4952:Grhl2 UTSW 15 37287249 missense probably benign 0.13
R5742:Grhl2 UTSW 15 37328372 missense probably damaging 1.00
R7142:Grhl2 UTSW 15 37279582 missense not run
Predicted Primers PCR Primer
(F):5'- AGGCATGATGTGCTTGGTTCACAG -3'
(R):5'- TTGTCAGAGCAAAAGCTACACCTCC -3'

Sequencing Primer
(F):5'- TCACAGGCATGATGTGCTGAG -3'
(R):5'- TCCACAACGAAAGGTCAAAAGAG -3'
Posted On2014-03-14