Incidental Mutation 'R1417:Phlpp2'
ID159857
Institutional Source Beutler Lab
Gene Symbol Phlpp2
Ensembl Gene ENSMUSG00000031732
Gene NamePH domain and leucine rich repeat protein phosphatase 2
SynonymsC130044A18Rik, Phlppl
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location109868542-109944671 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 109940681 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1281 (E1281*)
Ref Sequence ENSEMBL: ENSMUSP00000136166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034175] [ENSMUST00000179721]
Predicted Effect probably null
Transcript: ENSMUST00000034175
AA Change: E1246*
SMART Domains Protein: ENSMUSP00000034175
Gene: ENSMUSG00000031732
AA Change: E1246*

DomainStartEndE-ValueType
low complexity region 40 57 N/A INTRINSIC
Blast:PH 148 247 3e-61 BLAST
LRR 295 314 1.12e2 SMART
Pfam:LRR_7 319 335 3.5e-2 PFAM
LRR 341 363 2.82e0 SMART
LRR 364 387 9.75e0 SMART
LRR 456 479 2.68e1 SMART
LRR 498 517 1.35e1 SMART
LRR 521 540 5.59e1 SMART
LRR 544 563 2.79e1 SMART
LRR 569 589 1.62e1 SMART
LRR 590 609 1.67e1 SMART
LRR 616 641 1.33e2 SMART
LRR 640 659 1.4e1 SMART
LRR_TYP 664 687 6.78e-3 SMART
LRR 709 733 2.15e2 SMART
PP2Cc 772 1028 2.98e-30 SMART
low complexity region 1061 1095 N/A INTRINSIC
Blast:PP2Cc 1109 1175 8e-15 BLAST
low complexity region 1297 1315 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179721
AA Change: E1281*
SMART Domains Protein: ENSMUSP00000136166
Gene: ENSMUSG00000031732
AA Change: E1281*

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 75 92 N/A INTRINSIC
Blast:PH 183 282 4e-61 BLAST
LRR 330 349 1.12e2 SMART
LRR 376 398 2.82e0 SMART
LRR 399 422 9.75e0 SMART
LRR 491 514 2.68e1 SMART
LRR 533 552 1.35e1 SMART
LRR 556 575 5.59e1 SMART
LRR 579 598 2.79e1 SMART
LRR 604 624 1.62e1 SMART
LRR 625 644 1.67e1 SMART
LRR 651 676 1.33e2 SMART
LRR 675 694 1.4e1 SMART
LRR_TYP 699 722 6.78e-3 SMART
LRR 744 768 2.15e2 SMART
PP2Cc 807 1063 2.98e-30 SMART
low complexity region 1096 1130 N/A INTRINSIC
Blast:PP2Cc 1144 1210 8e-15 BLAST
low complexity region 1332 1350 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal susceptibility to DSS-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
G6pc2 T C 2: 69,222,968 V122A probably damaging Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in Phlpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Phlpp2 APN 8 109925790 missense probably benign 0.01
IGL01363:Phlpp2 APN 8 109937097 missense probably benign 0.22
IGL01535:Phlpp2 APN 8 109934065 missense possibly damaging 0.82
IGL01815:Phlpp2 APN 8 109939859 missense probably benign
IGL02105:Phlpp2 APN 8 109904408 missense probably damaging 1.00
IGL02257:Phlpp2 APN 8 109920099 missense possibly damaging 0.88
IGL02318:Phlpp2 APN 8 109939873 missense probably benign 0.04
IGL02500:Phlpp2 APN 8 109913618 missense probably benign
IGL03356:Phlpp2 APN 8 109935617 missense probably benign 0.00
IGL03366:Phlpp2 APN 8 109940835 missense probably benign 0.44
R0142:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0144:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0374:Phlpp2 UTSW 8 109907513 missense probably damaging 1.00
R0420:Phlpp2 UTSW 8 109939935 missense probably damaging 0.99
R0426:Phlpp2 UTSW 8 109928463 missense probably benign 0.01
R0477:Phlpp2 UTSW 8 109895506 critical splice acceptor site probably null
R0529:Phlpp2 UTSW 8 109876971 missense probably benign 0.00
R0605:Phlpp2 UTSW 8 109933211 missense probably benign 0.00
R0655:Phlpp2 UTSW 8 109895587 missense probably benign 0.00
R0833:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R0836:Phlpp2 UTSW 8 109937106 missense probably damaging 1.00
R1394:Phlpp2 UTSW 8 109877030 nonsense probably null
R1602:Phlpp2 UTSW 8 109934023 missense possibly damaging 0.96
R1650:Phlpp2 UTSW 8 109933955 splice site probably benign
R1815:Phlpp2 UTSW 8 109940223 missense probably damaging 1.00
R2045:Phlpp2 UTSW 8 109907600 missense probably damaging 1.00
R2072:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2074:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2075:Phlpp2 UTSW 8 109928492 missense possibly damaging 0.88
R2433:Phlpp2 UTSW 8 109940002 missense probably damaging 1.00
R3028:Phlpp2 UTSW 8 109907613 missense probably damaging 1.00
R4611:Phlpp2 UTSW 8 109876883 missense possibly damaging 0.79
R4718:Phlpp2 UTSW 8 109940820 missense probably benign 0.31
R4739:Phlpp2 UTSW 8 109940420 missense probably damaging 1.00
R4857:Phlpp2 UTSW 8 109877010 missense probably damaging 1.00
R5020:Phlpp2 UTSW 8 109940082 missense probably damaging 1.00
R5047:Phlpp2 UTSW 8 109913619 missense probably benign 0.04
R5074:Phlpp2 UTSW 8 109925829 missense probably damaging 0.99
R5330:Phlpp2 UTSW 8 109934035 missense probably damaging 0.99
R5663:Phlpp2 UTSW 8 109904344 missense probably benign 0.01
R5668:Phlpp2 UTSW 8 109928573 missense possibly damaging 0.67
R6433:Phlpp2 UTSW 8 109934685 missense probably benign
R6470:Phlpp2 UTSW 8 109937194 missense probably benign 0.45
R6804:Phlpp2 UTSW 8 109928565 missense probably damaging 1.00
X0018:Phlpp2 UTSW 8 109912369 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATAACCAACGGCAGCAGG -3'
(R):5'- GTCCACACGAGAGGTACAATCACAG -3'

Sequencing Primer
(F):5'- TAGACATCCATTGCTGCCGAG -3'
(R):5'- AGTGCTGTATCAAACTCCTCCAG -3'
Posted On2014-03-14