Incidental Mutation 'R1418:Nr4a2'
ID159885
Institutional Source Beutler Lab
Gene Symbol Nr4a2
Ensembl Gene ENSMUSG00000026826
Gene Namenuclear receptor subfamily 4, group A, member 2
SynonymsRNR-1, HZF-3, Nurr1
MMRRC Submission 039474-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1418 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location57106830-57124003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57108324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 543 (N543K)
Ref Sequence ENSEMBL: ENSMUSP00000108248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028166] [ENSMUST00000112627] [ENSMUST00000112629] [ENSMUST00000183542]
Predicted Effect probably damaging
Transcript: ENSMUST00000028166
AA Change: N543K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028166
Gene: ENSMUSG00000026826
AA Change: N543K

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112627
AA Change: N480K

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108246
Gene: ENSMUSG00000026826
AA Change: N480K

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
HOLI 345 503 1.03e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112629
AA Change: N543K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108248
Gene: ENSMUSG00000026826
AA Change: N543K

DomainStartEndE-ValueType
low complexity region 8 32 N/A INTRINSIC
low complexity region 124 134 N/A INTRINSIC
ZnF_C4 260 331 2.45e-39 SMART
low complexity region 346 363 N/A INTRINSIC
HOLI 408 566 1.03e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140165
Predicted Effect probably benign
Transcript: ENSMUST00000183542
SMART Domains Protein: ENSMUSP00000138824
Gene: ENSMUSG00000026826

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
ZnF_C4 197 268 2.45e-39 SMART
low complexity region 283 300 N/A INTRINSIC
Pfam:Hormone_recep 322 392 9.1e-8 PFAM
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 97% (92/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. The encoded protein may act as a transcription factor. Mutations in this gene have been associated with disorders related to dopaminergic dysfunction, including Parkinson disease, schizophernia, and manic depression. Misregulation of this gene may be associated with rheumatoid arthritis. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene fail to develop dopaminergic neurons in the mesencephalon and die within the first 12 hours of life. Heterozygotes suffer from reduced motor performance in old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Alb A G 5: 90,464,202 probably benign Het
Arnt A G 3: 95,470,399 probably benign Het
Asap2 A C 12: 21,239,585 N501H probably damaging Het
Asap2 A G 12: 21,239,589 E499G probably damaging Het
Atp5b C T 10: 128,083,298 probably benign Het
Atrnl1 G A 19: 57,935,705 probably null Het
AW554918 T G 18: 25,339,699 probably null Het
Bod1l G A 5: 41,819,471 T1500I probably damaging Het
Btbd11 C A 10: 85,645,578 T948K probably damaging Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dnah17 T A 11: 118,074,023 N2365Y probably damaging Het
Dnah7a T A 1: 53,647,236 probably benign Het
Dnajc16 G T 4: 141,767,741 S520* probably null Het
Dsg1b G T 18: 20,397,430 E381* probably null Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Endou A T 15: 97,718,973 probably benign Het
Epn2 A G 11: 61,523,086 S419P probably benign Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fat4 T C 3: 38,890,813 I1285T probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm13083 T A 4: 143,616,034 I237K probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gnas C T 2: 174,345,214 probably benign Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Hsd17b4 G T 18: 50,130,187 probably benign Het
Kmt2b A G 7: 30,576,960 probably benign Het
Lrch1 T C 14: 74,804,269 probably benign Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mtch2 A T 2: 90,853,015 probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Mug1 C T 6: 121,838,676 S13L probably benign Het
Naa25 T G 5: 121,423,734 L450R probably damaging Het
Nrp2 C T 1: 62,783,332 R695* probably null Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr373 T C 8: 72,100,387 L209P probably damaging Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Pclo A T 5: 14,678,130 probably benign Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Pkn3 T A 2: 30,083,047 V323E probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plppr2 C T 9: 21,947,789 P401S possibly damaging Het
Poln A G 5: 34,078,975 V604A probably benign Het
Prkd2 A G 7: 16,869,545 D800G probably benign Het
Ptprb A G 10: 116,319,470 T710A probably benign Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Ralbp1 A T 17: 65,859,148 probably benign Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Smcr8 T C 11: 60,778,032 I2T probably damaging Het
Smtnl2 T C 11: 72,401,421 T301A probably damaging Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Szt2 A T 4: 118,387,779 S1187T probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tfap2a T A 13: 40,717,204 M405L possibly damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tmem132b C A 5: 125,638,249 Q341K probably benign Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Utrn C T 10: 12,713,350 V871I probably benign Het
Vat1l T C 8: 114,282,361 probably benign Het
Vmn1r205 T C 13: 22,592,879 K18E probably benign Het
Zfp518a T A 19: 40,914,359 Y911N probably damaging Het
Zfyve28 A G 5: 34,217,246 C475R probably damaging Het
Other mutations in Nr4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Nr4a2 APN 2 57109217 missense probably damaging 1.00
IGL01148:Nr4a2 APN 2 57111971 missense probably benign 0.00
IGL01395:Nr4a2 APN 2 57112153 missense probably damaging 0.98
IGL02123:Nr4a2 APN 2 57111655 missense possibly damaging 0.95
IGL02311:Nr4a2 APN 2 57111731 missense probably benign
IGL02698:Nr4a2 APN 2 57108160 missense probably damaging 1.00
IGL03178:Nr4a2 APN 2 57110766 missense probably damaging 1.00
IGL03261:Nr4a2 APN 2 57110187 missense probably benign 0.40
R0025:Nr4a2 UTSW 2 57108615 missense probably benign 0.14
R0078:Nr4a2 UTSW 2 57112228 missense probably damaging 1.00
R1138:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R1222:Nr4a2 UTSW 2 57108324 missense probably damaging 0.97
R1755:Nr4a2 UTSW 2 57109092 missense probably damaging 1.00
R2265:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2266:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2267:Nr4a2 UTSW 2 57112006 missense possibly damaging 0.77
R2281:Nr4a2 UTSW 2 57112199 missense probably benign 0.00
R4191:Nr4a2 UTSW 2 57112379 missense probably damaging 0.96
R4706:Nr4a2 UTSW 2 57112213 missense probably damaging 1.00
R4707:Nr4a2 UTSW 2 57112093 missense probably benign 0.17
R4745:Nr4a2 UTSW 2 57110151 missense probably damaging 1.00
R4924:Nr4a2 UTSW 2 57112023 missense probably benign 0.00
R5350:Nr4a2 UTSW 2 57111865 missense probably damaging 0.98
R5495:Nr4a2 UTSW 2 57112375 missense probably damaging 1.00
R6139:Nr4a2 UTSW 2 57108689 missense probably damaging 0.98
R6156:Nr4a2 UTSW 2 57112352 missense probably damaging 1.00
R6325:Nr4a2 UTSW 2 57112418 missense probably damaging 1.00
R6674:Nr4a2 UTSW 2 57112424 missense probably damaging 1.00
R6786:Nr4a2 UTSW 2 57111908 missense probably benign 0.29
R7135:Nr4a2 UTSW 2 57112249 missense not run
Z1088:Nr4a2 UTSW 2 57111614 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGTTTTCTAAATCCAGGATGCCC -3'
(R):5'- AGTACTGCTGGTGCAGGACACTTC -3'

Sequencing Primer
(F):5'- GTGgtttgtttgtttgtttgtttAC -3'
(R):5'- GAACTTCCTCTGGTGGGAC -3'
Posted On2014-03-14