Incidental Mutation 'R1418:Endou'
Institutional Source Beutler Lab
Gene Symbol Endou
Ensembl Gene ENSMUSG00000022468
Gene Nameendonuclease, polyU-specific
SynonymsTcl-30, Pp11r
MMRRC Submission 039474-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1418 (G1)
Quality Score225
Status Validated
Chromosomal Location97711015-97731339 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 97718973 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023105] [ENSMUST00000100249] [ENSMUST00000230430]
Predicted Effect probably benign
Transcript: ENSMUST00000023105
SMART Domains Protein: ENSMUSP00000023105
Gene: ENSMUSG00000022468

transmembrane domain 13 35 N/A INTRINSIC
SO 127 169 1.93e-11 SMART
Pfam:XendoU 181 448 1.4e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100249
SMART Domains Protein: ENSMUSP00000097820
Gene: ENSMUSG00000022468

signal peptide 1 18 N/A INTRINSIC
SO 20 62 8.61e-9 SMART
SO 85 127 1.93e-11 SMART
Pfam:XendoU 136 407 2.8e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230430
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.5%
Validation Efficiency 97% (92/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with protease activity and is expressed in the placenta. The protein may be useful as a tumor marker. Multiple alternatively spliced transcript variants have been found for this protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal splenic B cell numbers and activation-induced B cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik T G 6: 52,179,151 probably benign Het
Adamts12 T A 15: 11,286,804 W832R probably damaging Het
Alb A G 5: 90,464,202 probably benign Het
Arnt A G 3: 95,470,399 probably benign Het
Asap2 A C 12: 21,239,585 N501H probably damaging Het
Asap2 A G 12: 21,239,589 E499G probably damaging Het
Atp5b C T 10: 128,083,298 probably benign Het
Atrnl1 G A 19: 57,935,705 probably null Het
AW554918 T G 18: 25,339,699 probably null Het
Bod1l G A 5: 41,819,471 T1500I probably damaging Het
Btbd11 C A 10: 85,645,578 T948K probably damaging Het
Cd101 A T 3: 101,018,775 Y209* probably null Het
Cdk12 T A 11: 98,241,785 S1013R unknown Het
Cntd1 T A 11: 101,285,740 L221Q possibly damaging Het
Cntn4 G A 6: 106,344,870 probably null Het
Col17a1 T A 19: 47,671,505 D336V probably damaging Het
Creb3l4 A G 3: 90,238,738 I193T possibly damaging Het
Cyp2d10 A T 15: 82,405,905 probably null Het
Dcun1d3 A G 7: 119,857,935 F185L probably damaging Het
Dnah17 T A 11: 118,074,023 N2365Y probably damaging Het
Dnah7a T A 1: 53,647,236 probably benign Het
Dnajc16 G T 4: 141,767,741 S520* probably null Het
Dsg1b G T 18: 20,397,430 E381* probably null Het
Dusp1 A G 17: 26,508,319 V2A probably benign Het
Elf1 T C 14: 79,560,775 V34A probably damaging Het
Epn2 A G 11: 61,523,086 S419P probably benign Het
Fam160b1 G A 19: 57,371,162 A45T possibly damaging Het
Fat4 T C 3: 38,890,813 I1285T probably damaging Het
Fcgr2b T C 1: 170,961,081 Y319C probably damaging Het
Gfra1 A C 19: 58,238,417 S461A possibly damaging Het
Gli2 T G 1: 118,841,936 I629L probably damaging Het
Gm13083 T A 4: 143,616,034 I237K probably benign Het
Gm17661 GA GAA 2: 90,917,709 noncoding transcript Het
Gm5096 A G 18: 87,757,334 K327R probably damaging Het
Gnas C T 2: 174,345,214 probably benign Het
Gpx3 G A 11: 54,909,596 V207I probably damaging Het
Hormad2 A G 11: 4,409,005 probably null Het
Hsd17b4 G T 18: 50,130,187 probably benign Het
Kmt2b A G 7: 30,576,960 probably benign Het
Lrch1 T C 14: 74,804,269 probably benign Het
Mark3 T C 12: 111,627,837 I307T possibly damaging Het
Mroh8 G A 2: 157,241,854 probably benign Het
Mtch2 A T 2: 90,853,015 probably benign Het
Mtif2 G A 11: 29,545,002 V701I probably benign Het
Mug1 C T 6: 121,838,676 S13L probably benign Het
Naa25 T G 5: 121,423,734 L450R probably damaging Het
Nr4a2 A T 2: 57,108,324 N543K probably damaging Het
Nrp2 C T 1: 62,783,332 R695* probably null Het
Olfr1115 G T 2: 87,252,422 G162C probably benign Het
Olfr373 T C 8: 72,100,387 L209P probably damaging Het
Olfr982 T A 9: 40,074,472 L59H probably damaging Het
Otog G T 7: 46,274,615 A1133S probably damaging Het
Pclo A T 5: 14,678,130 probably benign Het
Pdcd11 A G 19: 47,130,077 D1794G probably damaging Het
Pde4d C A 13: 109,950,387 S609* probably null Het
Pkn3 T A 2: 30,083,047 V323E probably damaging Het
Plekhd1 A G 12: 80,692,885 T3A probably benign Het
Plekhg4 G A 8: 105,379,110 A736T probably benign Het
Plppr2 C T 9: 21,947,789 P401S possibly damaging Het
Poln A G 5: 34,078,975 V604A probably benign Het
Prkd2 A G 7: 16,869,545 D800G probably benign Het
Ptprb A G 10: 116,319,470 T710A probably benign Het
Qrfpr C A 3: 36,180,095 G366W probably damaging Het
Qser1 C A 2: 104,777,431 A1471S probably damaging Het
Ralbp1 A T 17: 65,859,148 probably benign Het
Rars A T 11: 35,809,740 Y505N probably damaging Het
Sec24b T C 3: 130,007,423 N408S probably damaging Het
Slc38a9 T C 13: 112,690,180 C151R probably benign Het
Smcr8 T C 11: 60,778,032 I2T probably damaging Het
Smtnl2 T C 11: 72,401,421 T301A probably damaging Het
Smyd1 G A 6: 71,262,167 T13I probably benign Het
Sp110 G A 1: 85,594,385 H66Y probably benign Het
Szt2 A T 4: 118,387,779 S1187T probably benign Het
Tdo2 A G 3: 81,961,468 probably null Het
Tfap2a T A 13: 40,717,204 M405L possibly damaging Het
Thap12 A G 7: 98,716,830 D735G probably damaging Het
Tmem132b C A 5: 125,638,249 Q341K probably benign Het
Tnip3 T C 6: 65,597,429 V88A probably benign Het
Trim45 G T 3: 100,927,298 M432I probably benign Het
Ttn A G 2: 76,735,411 V28199A possibly damaging Het
Ube3b T C 5: 114,418,575 F989S probably damaging Het
Ubox5 A G 2: 130,600,290 L159P probably damaging Het
Uevld A T 7: 46,938,010 V314E possibly damaging Het
Uhrf1bp1 A G 17: 27,894,577 K1241R probably benign Het
Urb1 T C 16: 90,769,466 M1478V probably damaging Het
Utrn C T 10: 12,713,350 V871I probably benign Het
Vat1l T C 8: 114,282,361 probably benign Het
Vmn1r205 T C 13: 22,592,879 K18E probably benign Het
Zfp518a T A 19: 40,914,359 Y911N probably damaging Het
Zfyve28 A G 5: 34,217,246 C475R probably damaging Het
Other mutations in Endou
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0364:Endou UTSW 15 97718973 splice site probably benign
R1134:Endou UTSW 15 97713866 missense probably damaging 1.00
R1896:Endou UTSW 15 97712992 missense probably damaging 1.00
R2960:Endou UTSW 15 97713806 missense probably damaging 1.00
R4018:Endou UTSW 15 97718937 missense probably damaging 0.99
R4618:Endou UTSW 15 97713882 missense possibly damaging 0.67
R4754:Endou UTSW 15 97726539 missense probably damaging 0.99
R4807:Endou UTSW 15 97731232 missense probably benign 0.01
R4997:Endou UTSW 15 97719577 missense probably damaging 1.00
R5321:Endou UTSW 15 97721032 missense probably damaging 0.99
R5470:Endou UTSW 15 97718955 missense probably damaging 1.00
R5604:Endou UTSW 15 97720919 missense probably benign 0.00
R5764:Endou UTSW 15 97714607 missense probably damaging 1.00
R6114:Endou UTSW 15 97713876 nonsense probably null
R6404:Endou UTSW 15 97712131 missense probably damaging 1.00
R6528:Endou UTSW 15 97719629 missense probably damaging 1.00
R7089:Endou UTSW 15 97720245 missense not run
R7103:Endou UTSW 15 97718929 missense not run
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acatagaaaaaccctaactcaaaacc -3'
Posted On2014-03-14