Incidental Mutation 'R1420:Olfml2b'
ID160019
Institutional Source Beutler Lab
Gene Symbol Olfml2b
Ensembl Gene ENSMUSG00000038463
Gene Nameolfactomedin-like 2B
Synonymsphotomedin-2, 1110018N05Rik, 4832415H08Rik
MMRRC Submission 039476-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R1420 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location170644532-170682789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 170669027 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 409 (T409M)
Ref Sequence ENSEMBL: ENSMUSP00000047291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046792]
Predicted Effect probably benign
Transcript: ENSMUST00000046792
AA Change: T409M

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000047291
Gene: ENSMUSG00000038463
AA Change: T409M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 41 68 N/A INTRINSIC
coiled coil region 179 213 N/A INTRINSIC
low complexity region 233 238 N/A INTRINSIC
Blast:OLF 254 306 1e-6 BLAST
low complexity region 308 319 N/A INTRINSIC
low complexity region 343 382 N/A INTRINSIC
OLF 492 746 4.76e-61 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an olfactomedin domain-containing protein. Most olfactomedin domain-containing proteins are secreted glycoproteins. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,495,935 Y669H probably damaging Het
Amotl2 A T 9: 102,724,783 M409L possibly damaging Het
Ankrd35 A G 3: 96,684,738 E780G probably benign Het
Brwd1 T C 16: 96,036,034 Y866C probably damaging Het
Cul4b G C X: 38,565,041 probably null Het
Daw1 A T 1: 83,159,827 Y10F possibly damaging Het
Dgki A T 6: 37,050,269 probably null Het
Dnah3 A T 7: 119,951,979 V3039E probably damaging Het
Ercc4 C T 16: 13,130,209 T340I probably benign Het
Fam83b T C 9: 76,492,612 N403S possibly damaging Het
Fbxo18 A G 2: 11,767,682 F63L probably benign Het
Foxm1 G A 6: 128,372,921 R395H possibly damaging Het
Gtpbp4 C T 13: 8,973,262 A589T probably benign Het
Ifna7 C A 4: 88,816,669 H148N probably damaging Het
Il23r T C 6: 67,486,197 Y104C probably damaging Het
Il31ra A T 13: 112,531,752 W347R probably damaging Het
Ints7 T G 1: 191,613,057 F620V possibly damaging Het
Iqcd T C 5: 120,600,795 L226P probably damaging Het
Jak3 G T 8: 71,681,538 R428L possibly damaging Het
Kif28 C A 1: 179,702,397 C733F probably damaging Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Ksr2 A G 5: 117,414,839 E4G probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lrriq3 A G 3: 155,187,712 E350G probably benign Het
Nav3 G A 10: 109,823,254 A834V probably benign Het
Ncoa6 G A 2: 155,421,153 Q454* probably null Het
Nfatc2 C A 2: 168,504,665 M836I probably benign Het
Nphp3 G T 9: 104,035,893 probably null Het
Olfr955 A T 9: 39,469,993 H244Q probably damaging Het
Oprk1 A G 1: 5,602,321 K227R probably damaging Het
Pate1 A T 9: 35,685,209 W87R probably damaging Het
Pcnx4 T C 12: 72,555,986 Y341H probably benign Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pglyrp4 T C 3: 90,728,714 V82A probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Prdm9 C A 17: 15,544,376 C714F probably damaging Het
Pwp1 T C 10: 85,876,538 V80A probably damaging Het
Pxdn T C 12: 30,002,068 L568P probably damaging Het
Rasgrp4 C A 7: 29,140,345 Q161K probably damaging Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Slc16a6 A G 11: 109,454,946 V413A probably damaging Het
Slc7a15 T C 12: 8,534,442 T363A probably benign Het
Sufu T C 19: 46,397,184 S28P probably benign Het
Tex19.1 T C 11: 121,147,046 S77P probably damaging Het
Tmc7 A T 7: 118,566,217 Y91* probably null Het
Ttbk2 C G 2: 120,745,912 R792S probably benign Het
Tyw1 T C 5: 130,274,745 probably null Het
U2surp A G 9: 95,462,803 S907P probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vps50 T A 6: 3,588,007 L660* probably null Het
Wdr55 A G 18: 36,760,339 E18G probably benign Het
Wipi1 A G 11: 109,578,372 V331A probably benign Het
Other mutations in Olfml2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Olfml2b APN 1 170669066 missense probably damaging 0.96
IGL01871:Olfml2b APN 1 170662355 splice site probably benign
IGL02475:Olfml2b APN 1 170682174 missense probably damaging 1.00
IGL02657:Olfml2b APN 1 170681076 missense probably benign 0.00
IGL03375:Olfml2b APN 1 170649832 missense probably benign 0.35
R0040:Olfml2b UTSW 1 170668751 missense probably benign 0.00
R0194:Olfml2b UTSW 1 170681115 missense possibly damaging 0.89
R0834:Olfml2b UTSW 1 170647844 missense probably benign 0.00
R1218:Olfml2b UTSW 1 170649782 missense probably damaging 1.00
R1386:Olfml2b UTSW 1 170681162 missense probably damaging 0.97
R1699:Olfml2b UTSW 1 170645073 missense possibly damaging 0.89
R1730:Olfml2b UTSW 1 170681789 missense probably damaging 1.00
R1755:Olfml2b UTSW 1 170681777 missense probably damaging 1.00
R1869:Olfml2b UTSW 1 170669243 missense probably damaging 0.96
R2295:Olfml2b UTSW 1 170662538 splice site probably benign
R2394:Olfml2b UTSW 1 170649750 missense possibly damaging 0.82
R3784:Olfml2b UTSW 1 170681982 missense probably damaging 0.96
R4523:Olfml2b UTSW 1 170669222 missense probably benign
R4611:Olfml2b UTSW 1 170644947 missense probably damaging 0.99
R4900:Olfml2b UTSW 1 170662378 missense probably damaging 1.00
R5201:Olfml2b UTSW 1 170668864 missense probably benign
R5245:Olfml2b UTSW 1 170668874 missense probably benign
R5268:Olfml2b UTSW 1 170649761 missense probably damaging 1.00
R5283:Olfml2b UTSW 1 170681189 nonsense probably null
R5348:Olfml2b UTSW 1 170662426 missense probably benign 0.02
R5408:Olfml2b UTSW 1 170644976 missense probably damaging 1.00
R5673:Olfml2b UTSW 1 170682129 missense probably damaging 1.00
R5758:Olfml2b UTSW 1 170669264 critical splice donor site probably null
R5893:Olfml2b UTSW 1 170662473 missense probably benign
R6290:Olfml2b UTSW 1 170649790 nonsense probably null
R6380:Olfml2b UTSW 1 170669231 missense probably benign 0.00
R6778:Olfml2b UTSW 1 170645070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGACTGATGCGAGCATTCAGG -3'
(R):5'- ACCAGTCCAGGGAAGAAGGACTTAC -3'

Sequencing Primer
(F):5'- ATTCAGGCCGCAGCCTC -3'
(R):5'- TCCAGGGAAGAAGGACTTACCTATC -3'
Posted On2014-03-14