Incidental Mutation 'R1420:Fbxo18'
ID160022
Institutional Source Beutler Lab
Gene Symbol Fbxo18
Ensembl Gene ENSMUSG00000058594
Gene NameF-box protein 18
SynonymsFbx18
MMRRC Submission 039476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R1420 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location11742573-11777582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11767682 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 63 (F63L)
Ref Sequence ENSEMBL: ENSMUSP00000071495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071564]
Predicted Effect probably benign
Transcript: ENSMUST00000071564
AA Change: F63L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000071495
Gene: ENSMUSG00000058594
AA Change: F63L

DomainStartEndE-ValueType
FBOX 213 256 3.94e-3 SMART
Pfam:UvrD-helicase 626 692 8e-10 PFAM
Pfam:UvrD_C 862 935 1.7e-12 PFAM
Pfam:UvrD_C_2 867 931 1.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192171
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. It contains an F-box motif and seven conserved helicase motifs, and has both DNA-dependent ATPase and DNA unwinding activities. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,495,935 Y669H probably damaging Het
Amotl2 A T 9: 102,724,783 M409L possibly damaging Het
Ankrd35 A G 3: 96,684,738 E780G probably benign Het
Brwd1 T C 16: 96,036,034 Y866C probably damaging Het
Cul4b G C X: 38,565,041 probably null Het
Daw1 A T 1: 83,159,827 Y10F possibly damaging Het
Dgki A T 6: 37,050,269 probably null Het
Dnah3 A T 7: 119,951,979 V3039E probably damaging Het
Ercc4 C T 16: 13,130,209 T340I probably benign Het
Fam83b T C 9: 76,492,612 N403S possibly damaging Het
Foxm1 G A 6: 128,372,921 R395H possibly damaging Het
Gtpbp4 C T 13: 8,973,262 A589T probably benign Het
Ifna7 C A 4: 88,816,669 H148N probably damaging Het
Il23r T C 6: 67,486,197 Y104C probably damaging Het
Il31ra A T 13: 112,531,752 W347R probably damaging Het
Ints7 T G 1: 191,613,057 F620V possibly damaging Het
Iqcd T C 5: 120,600,795 L226P probably damaging Het
Jak3 G T 8: 71,681,538 R428L possibly damaging Het
Kif28 C A 1: 179,702,397 C733F probably damaging Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Ksr2 A G 5: 117,414,839 E4G probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lrriq3 A G 3: 155,187,712 E350G probably benign Het
Nav3 G A 10: 109,823,254 A834V probably benign Het
Ncoa6 G A 2: 155,421,153 Q454* probably null Het
Nfatc2 C A 2: 168,504,665 M836I probably benign Het
Nphp3 G T 9: 104,035,893 probably null Het
Olfml2b C T 1: 170,669,027 T409M probably benign Het
Olfr955 A T 9: 39,469,993 H244Q probably damaging Het
Oprk1 A G 1: 5,602,321 K227R probably damaging Het
Pate1 A T 9: 35,685,209 W87R probably damaging Het
Pcnx4 T C 12: 72,555,986 Y341H probably benign Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pglyrp4 T C 3: 90,728,714 V82A probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Prdm9 C A 17: 15,544,376 C714F probably damaging Het
Pwp1 T C 10: 85,876,538 V80A probably damaging Het
Pxdn T C 12: 30,002,068 L568P probably damaging Het
Rasgrp4 C A 7: 29,140,345 Q161K probably damaging Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Slc16a6 A G 11: 109,454,946 V413A probably damaging Het
Slc7a15 T C 12: 8,534,442 T363A probably benign Het
Sufu T C 19: 46,397,184 S28P probably benign Het
Tex19.1 T C 11: 121,147,046 S77P probably damaging Het
Tmc7 A T 7: 118,566,217 Y91* probably null Het
Ttbk2 C G 2: 120,745,912 R792S probably benign Het
Tyw1 T C 5: 130,274,745 probably null Het
U2surp A G 9: 95,462,803 S907P probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vps50 T A 6: 3,588,007 L660* probably null Het
Wdr55 A G 18: 36,760,339 E18G probably benign Het
Wipi1 A G 11: 109,578,372 V331A probably benign Het
Other mutations in Fbxo18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Fbxo18 APN 2 11757523 nonsense probably null
IGL02081:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02082:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02084:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02086:Fbxo18 APN 2 11764127 missense probably benign 0.31
IGL02369:Fbxo18 APN 2 11747158 missense possibly damaging 0.61
IGL02584:Fbxo18 APN 2 11759958 missense probably benign 0.07
IGL03138:Fbxo18 UTSW 2 11749509 intron probably benign
R0384:Fbxo18 UTSW 2 11749578 missense probably damaging 1.00
R0479:Fbxo18 UTSW 2 11758419 missense probably damaging 1.00
R0972:Fbxo18 UTSW 2 11764088 splice site probably benign
R1827:Fbxo18 UTSW 2 11763888 missense possibly damaging 0.88
R1832:Fbxo18 UTSW 2 11767400 missense probably benign 0.08
R1960:Fbxo18 UTSW 2 11757528 missense probably damaging 0.98
R2040:Fbxo18 UTSW 2 11769895 missense possibly damaging 0.66
R2044:Fbxo18 UTSW 2 11762970 missense possibly damaging 0.89
R2102:Fbxo18 UTSW 2 11758289 missense probably benign 0.18
R3236:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R3975:Fbxo18 UTSW 2 11767210 missense possibly damaging 0.72
R4504:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4505:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4507:Fbxo18 UTSW 2 11749017 missense possibly damaging 0.91
R4799:Fbxo18 UTSW 2 11755747 missense probably damaging 1.00
R4894:Fbxo18 UTSW 2 11762960 missense probably damaging 1.00
R4994:Fbxo18 UTSW 2 11764230 missense probably damaging 1.00
R5579:Fbxo18 UTSW 2 11748993 missense probably damaging 0.97
R5801:Fbxo18 UTSW 2 11769826 missense probably damaging 1.00
R6255:Fbxo18 UTSW 2 11748446 missense probably benign 0.31
R7011:Fbxo18 UTSW 2 11762963 missense probably damaging 1.00
R7177:Fbxo18 UTSW 2 11755711 missense probably damaging 1.00
R7243:Fbxo18 UTSW 2 11751525 missense probably benign 0.11
R7331:Fbxo18 UTSW 2 11763986 missense probably benign
R7361:Fbxo18 UTSW 2 11747076 missense probably damaging 1.00
R7460:Fbxo18 UTSW 2 11756685 missense probably benign 0.38
R7541:Fbxo18 UTSW 2 11749537 missense not run
Predicted Primers PCR Primer
(F):5'- GCCTTGAACACGATGGGAACAAAC -3'
(R):5'- GGTGTCCAGTGTGCAGCATCTAAAC -3'

Sequencing Primer
(F):5'- TGTGGCTTCCTCAAAGCAG -3'
(R):5'- CTTACAGGCTAGAGTGTTGACCAG -3'
Posted On2014-03-14