Incidental Mutation 'R1420:Rasgrp4'
ID160041
Institutional Source Beutler Lab
Gene Symbol Rasgrp4
Ensembl Gene ENSMUSG00000030589
Gene NameRAS guanyl releasing protein 4
Synonyms
MMRRC Submission 039476-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1420 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29134851-29153961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 29140345 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 161 (Q161K)
Ref Sequence ENSEMBL: ENSMUSP00000125137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032811] [ENSMUST00000094617] [ENSMUST00000159351] [ENSMUST00000159975] [ENSMUST00000160194] [ENSMUST00000161522] [ENSMUST00000203070] [ENSMUST00000203380] [ENSMUST00000204194] [ENSMUST00000204845] [ENSMUST00000205027]
Predicted Effect probably damaging
Transcript: ENSMUST00000032811
AA Change: Q161K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032811
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 590 4.12e-12 SMART
low complexity region 600 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094617
AA Change: Q162K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092200
Gene: ENSMUSG00000030589
AA Change: Q162K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 163 2e-29 BLAST
low complexity region 164 189 N/A INTRINSIC
RasGEF 198 434 2.92e-70 SMART
C1 542 596 1.81e-8 SMART
low complexity region 606 615 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159351
AA Change: Q161K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124183
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 7e-31 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
Blast:RasGEF 449 553 7e-25 BLAST
SCOP:d1ptq__ 541 573 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159898
Predicted Effect probably damaging
Transcript: ENSMUST00000159975
AA Change: Q161K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125137
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 1e-30 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 433 2.92e-70 SMART
C1 541 595 1.81e-8 SMART
low complexity region 605 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160194
AA Change: Q161K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124908
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 162 8e-32 BLAST
low complexity region 163 188 N/A INTRINSIC
RasGEF 197 423 6.73e-61 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161522
AA Change: Q161K

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123718
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Blast:RasGEFN 66 165 7e-32 BLAST
RasGEF 183 419 2.92e-70 SMART
C1 527 576 4.12e-12 SMART
low complexity region 586 595 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162946
Predicted Effect possibly damaging
Transcript: ENSMUST00000203070
AA Change: Q161K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000145352
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 504 1.8e-20 SMART
C1 449 498 2.1e-14 SMART
low complexity region 508 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203380
AA Change: Q161K

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144753
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 364 3e-25 SMART
C1 472 521 2.1e-14 SMART
low complexity region 531 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204194
AA Change: Q161K

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000145259
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 85 336 1e-7 SMART
C1 444 493 2.1e-14 SMART
low complexity region 503 512 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000204845
AA Change: Q161K

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144774
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
RasGEF 197 399 8.7e-49 SMART
C1 507 556 2.1e-14 SMART
low complexity region 566 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205027
AA Change: Q161K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000145186
Gene: ENSMUSG00000030589
AA Change: Q161K

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
RasGEFN 48 172 2.6e-3 SMART
C1 352 401 2.1e-14 SMART
low complexity region 411 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ras guanyl nucleotide-releasing protein (RasGRP) family of Ras guanine nucleotide exchange factors. It contains a Ras exchange motif, a diacylglycerol-binding domain, and two calcium-binding EF hands. This protein was shown to activate H-Ras in a cation-dependent manner in vitro. Expression of this protein in myeloid cell lines was found to be correlated with elevated level of activated RAS protein, and the RAS activation can be greatly enhanced by phorbol ester treatment, which suggested a role of this protein in diacylglycerol regulated cell signaling pathways. Studies of a mast cell leukemia cell line expressing substantial amounts of abnormal transcripts of this gene indicated that this gene may play an important role in the final stages of mast cell development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired neutrophil reactive oxygen species production and chemotaxis in vitro. Mice homozygous for another knock-out allele exhibit decreased susceptibility to induced colitis and arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,495,935 Y669H probably damaging Het
Amotl2 A T 9: 102,724,783 M409L possibly damaging Het
Ankrd35 A G 3: 96,684,738 E780G probably benign Het
Brwd1 T C 16: 96,036,034 Y866C probably damaging Het
Cul4b G C X: 38,565,041 probably null Het
Daw1 A T 1: 83,159,827 Y10F possibly damaging Het
Dgki A T 6: 37,050,269 probably null Het
Dnah3 A T 7: 119,951,979 V3039E probably damaging Het
Ercc4 C T 16: 13,130,209 T340I probably benign Het
Fam83b T C 9: 76,492,612 N403S possibly damaging Het
Fbxo18 A G 2: 11,767,682 F63L probably benign Het
Foxm1 G A 6: 128,372,921 R395H possibly damaging Het
Gtpbp4 C T 13: 8,973,262 A589T probably benign Het
Ifna7 C A 4: 88,816,669 H148N probably damaging Het
Il23r T C 6: 67,486,197 Y104C probably damaging Het
Il31ra A T 13: 112,531,752 W347R probably damaging Het
Ints7 T G 1: 191,613,057 F620V possibly damaging Het
Iqcd T C 5: 120,600,795 L226P probably damaging Het
Jak3 G T 8: 71,681,538 R428L possibly damaging Het
Kif28 C A 1: 179,702,397 C733F probably damaging Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Ksr2 A G 5: 117,414,839 E4G probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lrriq3 A G 3: 155,187,712 E350G probably benign Het
Nav3 G A 10: 109,823,254 A834V probably benign Het
Ncoa6 G A 2: 155,421,153 Q454* probably null Het
Nfatc2 C A 2: 168,504,665 M836I probably benign Het
Nphp3 G T 9: 104,035,893 probably null Het
Olfml2b C T 1: 170,669,027 T409M probably benign Het
Olfr955 A T 9: 39,469,993 H244Q probably damaging Het
Oprk1 A G 1: 5,602,321 K227R probably damaging Het
Pate1 A T 9: 35,685,209 W87R probably damaging Het
Pcnx4 T C 12: 72,555,986 Y341H probably benign Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pglyrp4 T C 3: 90,728,714 V82A probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Prdm9 C A 17: 15,544,376 C714F probably damaging Het
Pwp1 T C 10: 85,876,538 V80A probably damaging Het
Pxdn T C 12: 30,002,068 L568P probably damaging Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Slc16a6 A G 11: 109,454,946 V413A probably damaging Het
Slc7a15 T C 12: 8,534,442 T363A probably benign Het
Sufu T C 19: 46,397,184 S28P probably benign Het
Tex19.1 T C 11: 121,147,046 S77P probably damaging Het
Tmc7 A T 7: 118,566,217 Y91* probably null Het
Ttbk2 C G 2: 120,745,912 R792S probably benign Het
Tyw1 T C 5: 130,274,745 probably null Het
U2surp A G 9: 95,462,803 S907P probably benign Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vps50 T A 6: 3,588,007 L660* probably null Het
Wdr55 A G 18: 36,760,339 E18G probably benign Het
Wipi1 A G 11: 109,578,372 V331A probably benign Het
Other mutations in Rasgrp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Rasgrp4 APN 7 29148541 splice site probably benign
IGL01145:Rasgrp4 APN 7 29151473 missense possibly damaging 0.83
IGL01806:Rasgrp4 APN 7 29139050 missense possibly damaging 0.83
IGL02023:Rasgrp4 APN 7 29138910 missense probably damaging 1.00
IGL02499:Rasgrp4 APN 7 29151503 utr 3 prime probably benign
IGL02989:Rasgrp4 APN 7 29148406 missense probably damaging 1.00
IGL03281:Rasgrp4 APN 7 29146025 missense possibly damaging 0.69
R0092:Rasgrp4 UTSW 7 29145132 missense possibly damaging 0.74
R0390:Rasgrp4 UTSW 7 29145860 missense probably damaging 1.00
R0614:Rasgrp4 UTSW 7 29145851 missense probably damaging 1.00
R0628:Rasgrp4 UTSW 7 29140210 intron probably benign
R1434:Rasgrp4 UTSW 7 29137727 critical splice donor site probably null
R1664:Rasgrp4 UTSW 7 29140263 missense probably benign 0.00
R1911:Rasgrp4 UTSW 7 29138877 missense probably damaging 1.00
R2164:Rasgrp4 UTSW 7 29139045 missense probably damaging 1.00
R4277:Rasgrp4 UTSW 7 29152594 unclassified probably benign
R5024:Rasgrp4 UTSW 7 29148407 missense probably damaging 1.00
R5423:Rasgrp4 UTSW 7 29145136 missense probably damaging 1.00
R5813:Rasgrp4 UTSW 7 29145214 missense probably damaging 1.00
R5823:Rasgrp4 UTSW 7 29137717 missense probably benign 0.00
R6268:Rasgrp4 UTSW 7 29143068 missense probably damaging 1.00
R6285:Rasgrp4 UTSW 7 29148383 missense probably damaging 1.00
Z1088:Rasgrp4 UTSW 7 29150536 intron probably benign
Predicted Primers PCR Primer
(F):5'- CACCCGTGTAAATGCCCATAGTTCC -3'
(R):5'- TAAGTGAGGTGTTGTGCCAGCTCC -3'

Sequencing Primer
(F):5'- AGAATTCCTTGGCTTAAAGCCC -3'
(R):5'- CTGTCTCCAGGTGATCGAATAGC -3'
Posted On2014-03-14