Incidental Mutation 'R1420:Vmn2r115'
ID160076
Institutional Source Beutler Lab
Gene Symbol Vmn2r115
Ensembl Gene ENSMUSG00000091076
Gene Namevomeronasal 2, receptor 115
SynonymsEG638102
MMRRC Submission 039476-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R1420 (G1)
Quality Score174
Status Not validated
Chromosome17
Chromosomal Location23343977-23360128 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ATCTTCT to ATCT at 23359988 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168175]
Predicted Effect probably benign
Transcript: ENSMUST00000168175
SMART Domains Protein: ENSMUSP00000131447
Gene: ENSMUSG00000091076

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 471 1.4e-28 PFAM
Pfam:NCD3G 512 565 2.9e-20 PFAM
Pfam:7tm_3 598 833 5e-55 PFAM
Meta Mutation Damage Score 0.1448 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l2 A G 10: 83,495,935 Y669H probably damaging Het
Amotl2 A T 9: 102,724,783 M409L possibly damaging Het
Ankrd35 A G 3: 96,684,738 E780G probably benign Het
Brwd1 T C 16: 96,036,034 Y866C probably damaging Het
Cul4b G C X: 38,565,041 probably null Het
Daw1 A T 1: 83,159,827 Y10F possibly damaging Het
Dgki A T 6: 37,050,269 probably null Het
Dnah3 A T 7: 119,951,979 V3039E probably damaging Het
Ercc4 C T 16: 13,130,209 T340I probably benign Het
Fam83b T C 9: 76,492,612 N403S possibly damaging Het
Fbxo18 A G 2: 11,767,682 F63L probably benign Het
Foxm1 G A 6: 128,372,921 R395H possibly damaging Het
Gtpbp4 C T 13: 8,973,262 A589T probably benign Het
Ifna7 C A 4: 88,816,669 H148N probably damaging Het
Il23r T C 6: 67,486,197 Y104C probably damaging Het
Il31ra A T 13: 112,531,752 W347R probably damaging Het
Ints7 T G 1: 191,613,057 F620V possibly damaging Het
Iqcd T C 5: 120,600,795 L226P probably damaging Het
Jak3 G T 8: 71,681,538 R428L possibly damaging Het
Kif28 C A 1: 179,702,397 C733F probably damaging Het
Klkb1 C A 8: 45,276,146 C347F probably damaging Het
Ksr2 A G 5: 117,414,839 E4G probably benign Het
Lama1 T C 17: 67,790,947 L1774P probably damaging Het
Lrriq3 A G 3: 155,187,712 E350G probably benign Het
Nav3 G A 10: 109,823,254 A834V probably benign Het
Ncoa6 G A 2: 155,421,153 Q454* probably null Het
Nfatc2 C A 2: 168,504,665 M836I probably benign Het
Nphp3 G T 9: 104,035,893 probably null Het
Olfml2b C T 1: 170,669,027 T409M probably benign Het
Olfr955 A T 9: 39,469,993 H244Q probably damaging Het
Oprk1 A G 1: 5,602,321 K227R probably damaging Het
Pate1 A T 9: 35,685,209 W87R probably damaging Het
Pcnx4 T C 12: 72,555,986 Y341H probably benign Het
Pde4c T A 8: 70,748,417 H421Q probably damaging Het
Pglyrp4 T C 3: 90,728,714 V82A probably damaging Het
Pnmt G T 11: 98,387,676 R156L probably benign Het
Prdm9 C A 17: 15,544,376 C714F probably damaging Het
Pwp1 T C 10: 85,876,538 V80A probably damaging Het
Pxdn T C 12: 30,002,068 L568P probably damaging Het
Rasgrp4 C A 7: 29,140,345 Q161K probably damaging Het
Rnf138 A G 18: 21,026,102 E193G probably damaging Het
Slc16a6 A G 11: 109,454,946 V413A probably damaging Het
Slc7a15 T C 12: 8,534,442 T363A probably benign Het
Sufu T C 19: 46,397,184 S28P probably benign Het
Tex19.1 T C 11: 121,147,046 S77P probably damaging Het
Tmc7 A T 7: 118,566,217 Y91* probably null Het
Ttbk2 C G 2: 120,745,912 R792S probably benign Het
Tyw1 T C 5: 130,274,745 probably null Het
U2surp A G 9: 95,462,803 S907P probably benign Het
Vps50 T A 6: 3,588,007 L660* probably null Het
Wdr55 A G 18: 36,760,339 E18G probably benign Het
Wipi1 A G 11: 109,578,372 V331A probably benign Het
Other mutations in Vmn2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Vmn2r115 APN 17 23346206 missense possibly damaging 0.90
IGL00990:Vmn2r115 APN 17 23346176 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23359349 missense probably benign 0.22
IGL00990:Vmn2r115 APN 17 23346339 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346278 missense probably benign 0.14
IGL00990:Vmn2r115 APN 17 23346161 missense probably benign 0.03
IGL00990:Vmn2r115 APN 17 23359397 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23346371 nonsense probably null
IGL00990:Vmn2r115 APN 17 23346372 missense probably benign 0.30
IGL00990:Vmn2r115 APN 17 23356960 missense probably benign 0.00
IGL00990:Vmn2r115 APN 17 23346264 missense probably benign 0.19
IGL00990:Vmn2r115 APN 17 23359779 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23359824 missense probably damaging 1.00
IGL00990:Vmn2r115 APN 17 23348034 nonsense probably null
IGL01073:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01101:Vmn2r115 APN 17 23345997 missense probably benign 0.12
IGL01300:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL01415:Vmn2r115 APN 17 23359781 missense probably damaging 1.00
IGL02309:Vmn2r115 APN 17 23345139 missense probably benign 0.01
IGL02863:Vmn2r115 APN 17 23359283 missense probably damaging 0.97
R0023:Vmn2r115 UTSW 17 23346278 missense probably benign 0.14
R0197:Vmn2r115 UTSW 17 23359781 missense probably damaging 1.00
R0361:Vmn2r115 UTSW 17 23345222 missense probably benign 0.11
R0601:Vmn2r115 UTSW 17 23360100 missense probably null 0.51
R0676:Vmn2r115 UTSW 17 23346264 missense probably benign 0.19
R0685:Vmn2r115 UTSW 17 23359275 missense probably benign
R0865:Vmn2r115 UTSW 17 23346408 missense possibly damaging 0.65
R1124:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1145:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1146:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1207:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1266:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1318:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1367:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1376:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1469:Vmn2r115 UTSW 17 23346018 missense probably damaging 0.99
R1604:Vmn2r115 UTSW 17 23345271 missense probably benign 0.12
R1645:Vmn2r115 UTSW 17 23346218 missense possibly damaging 0.69
R1646:Vmn2r115 UTSW 17 23359539 missense probably damaging 1.00
R1650:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1678:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1716:Vmn2r115 UTSW 17 23347821 missense probably benign
R1846:Vmn2r115 UTSW 17 23359383 missense probably damaging 1.00
R1847:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1885:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R1887:Vmn2r115 UTSW 17 23346033 missense possibly damaging 0.91
R1937:Vmn2r115 UTSW 17 23359414 missense probably damaging 1.00
R2007:Vmn2r115 UTSW 17 23347953 missense possibly damaging 0.94
R2120:Vmn2r115 UTSW 17 23359323 missense probably damaging 1.00
R3161:Vmn2r115 UTSW 17 23357024 missense possibly damaging 0.82
R3780:Vmn2r115 UTSW 17 23345172 missense probably damaging 1.00
R3806:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R3982:Vmn2r115 UTSW 17 23359974 missense probably damaging 1.00
R4019:Vmn2r115 UTSW 17 23360043 missense probably damaging 1.00
R4039:Vmn2r115 UTSW 17 23345103 missense probably benign 0.26
R4087:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4089:Vmn2r115 UTSW 17 23346384 missense probably benign 0.35
R4379:Vmn2r115 UTSW 17 23345223 missense possibly damaging 0.95
R4417:Vmn2r115 UTSW 17 23345880 missense probably benign 0.02
R4601:Vmn2r115 UTSW 17 23346399 missense probably benign 0.01
R4874:Vmn2r115 UTSW 17 23359851 missense probably damaging 1.00
R5466:Vmn2r115 UTSW 17 23360056 missense probably damaging 1.00
R5613:Vmn2r115 UTSW 17 23345333 missense probably benign
R5821:Vmn2r115 UTSW 17 23347963 missense probably damaging 0.99
R6120:Vmn2r115 UTSW 17 23346029 missense probably damaging 1.00
R6193:Vmn2r115 UTSW 17 23357009 missense probably benign 0.01
R6213:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6290:Vmn2r115 UTSW 17 23359988 small deletion probably benign
R6319:Vmn2r115 UTSW 17 23347903 missense possibly damaging 0.70
R6495:Vmn2r115 UTSW 17 23359598 missense probably benign 0.02
R6599:Vmn2r115 UTSW 17 23346032 missense probably benign 0.00
R6764:Vmn2r115 UTSW 17 23346072 missense probably damaging 1.00
R6970:Vmn2r115 UTSW 17 23346015 missense probably benign 0.23
R7023:Vmn2r115 UTSW 17 23359811 missense probably damaging 1.00
R7236:Vmn2r115 UTSW 17 23359602 missense probably benign 0.01
V5622:Vmn2r115 UTSW 17 23346227 missense probably damaging 1.00
V5622:Vmn2r115 UTSW 17 23359359 missense probably benign
X0023:Vmn2r115 UTSW 17 23359988 small deletion probably benign
X0033:Vmn2r115 UTSW 17 23359988 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TGTATGCCACAAGGGTTCAGTCAATG -3'
(R):5'- GCCAGGCAATATCCTTAGAGGAAACAG -3'

Sequencing Primer
(F):5'- CTGGGATACTTGGCTACCCTG -3'
(R):5'- CAGTGAGAGTTATTCCACCATCAG -3'
Posted On2014-03-14