Incidental Mutation 'R1401:Bbs7'
ID160098
Institutional Source Beutler Lab
Gene Symbol Bbs7
Ensembl Gene ENSMUSG00000037325
Gene NameBardet-Biedl syndrome 7 (human)
Synonyms8430406N16Rik
MMRRC Submission 039463-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1401 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location36573142-36613477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36573557 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 694 (P694S)
Ref Sequence ENSEMBL: ENSMUSP00000103791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029270] [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156] [ENSMUST00000147380] [ENSMUST00000196316]
Predicted Effect probably benign
Transcript: ENSMUST00000029270
SMART Domains Protein: ENSMUSP00000029270
Gene: ENSMUSG00000027715

DomainStartEndE-ValueType
Pfam:Cyclin_N2 22 157 7.2e-50 PFAM
CYCLIN 206 290 1.07e-28 SMART
Cyclin_C 299 417 4.09e-31 SMART
CYCLIN 303 386 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040148
AA Change: P694S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325
AA Change: P694S

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
AA Change: P694S

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325
AA Change: P694S

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145309
Predicted Effect probably benign
Transcript: ENSMUST00000147380
Predicted Effect probably benign
Transcript: ENSMUST00000196316
SMART Domains Protein: ENSMUSP00000142946
Gene: ENSMUSG00000027715

DomainStartEndE-ValueType
CYCLIN 69 153 6.6e-31 SMART
Cyclin_C 162 280 2e-35 SMART
CYCLIN 166 249 6.1e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199136
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex containing BBS1, BBS2, BBS4, BBS5, BBS7, BBS8, BBS9 and BBIP10. The BBSome complex is believed to recruit Rab8(GTP) to the primary cilium and promote ciliogenesis. The BBSome complex assembly is mediated by a complex composed of three chaperonin-like BBS proteins (BBS6, BBS10, and BBS12) and CCT/TRiC family chaperonins. Mutations in this gene are implicated in Bardet-Biedl syndrome, a genetic disorder whose symptoms include obesity, retinal degeneration, polydactyly and nephropathy; however, mutations in this gene and the BBS8 gene are thought to play a minor role and mutations in chaperonin-like BBS genes are found to be a major contributor to disease development in a multiethnic Bardet-Biedl syndrome patient population. Two transcript variants encoding distinct isoforms have been identified for this gene.[provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial preweaning lethality, retinal degeneration, obesity, ventriculomegaly, abnormal brain ependyma motile cilium morphology, and male infertility characterized by abnormal sperm flagellar axoneme structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abcg1 T A 17: 31,114,158 I625N possibly damaging Het
Adam33 C A 2: 131,051,471 probably benign Het
Adgrl2 A T 3: 148,822,981 I1185N probably damaging Het
Afp A T 5: 90,501,627 probably benign Het
Aggf1 A G 13: 95,364,848 V342A probably benign Het
Ankrd11 A T 8: 122,893,050 S1333R probably benign Het
Arhgef11 C A 3: 87,733,469 S1311* probably null Het
Atp6v1g1 T C 4: 63,548,641 Y47H probably benign Het
Atp8b4 T C 2: 126,323,093 probably null Het
Barx2 A G 9: 31,859,031 L67P probably damaging Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
C2 T C 17: 34,872,481 T69A possibly damaging Het
C8b T G 4: 104,784,482 L205R possibly damaging Het
Cct4 T G 11: 22,994,333 N72K probably damaging Het
Cd300lg C A 11: 102,054,155 P353H possibly damaging Het
Cdh20 A T 1: 104,947,497 I335L possibly damaging Het
Cfhr2 T A 1: 139,811,019 H268L probably benign Het
Chia1 T A 3: 106,128,939 D278E probably benign Het
Cntn6 A G 6: 104,804,398 T482A possibly damaging Het
Cst13 T A 2: 148,823,096 F4I probably benign Het
Ctsc T A 7: 88,281,498 V95E probably damaging Het
Ddhd1 A T 14: 45,605,051 probably null Het
Dmxl2 A T 9: 54,415,428 probably null Het
Dnah5 A C 15: 28,401,913 T3407P probably damaging Het
Dock1 T A 7: 135,133,936 Y1344* probably null Het
Eif4g3 T C 4: 138,206,084 V1740A probably damaging Het
Epb41l5 A G 1: 119,578,904 probably benign Het
Fam159b A T 13: 104,863,605 C37S probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Gm12790 A G 4: 101,968,199 L6P probably benign Het
Gramd4 A G 15: 86,125,196 D210G probably damaging Het
Hectd3 T C 4: 117,002,269 S697P possibly damaging Het
Hsf4 T C 8: 105,275,603 V399A probably benign Het
Hyal6 T A 6: 24,743,435 C377S probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Mypn A G 10: 63,152,857 V463A probably damaging Het
Nav1 T A 1: 135,460,425 I1144L probably benign Het
Nckap5 A G 1: 126,014,661 probably benign Het
Nipbl A T 15: 8,372,173 S30T probably damaging Het
Nmt1 T C 11: 103,057,481 F277S probably damaging Het
Nploc4 A C 11: 120,383,289 probably benign Het
Nup54 C A 5: 92,428,221 R137I probably damaging Het
Olfr667 T C 7: 104,916,756 Y180C probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pkd1l1 G T 11: 8,854,487 Y1701* probably null Het
Plekhg6 T C 6: 125,363,109 T763A probably damaging Het
Pmepa1 C T 2: 173,228,575 probably null Het
Ppfia2 A G 10: 106,830,657 E408G possibly damaging Het
Pramef12 G A 4: 144,395,088 T122M probably benign Het
Prl8a2 G A 13: 27,353,996 V218I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
RP23-114B10.6 T C 8: 69,373,370 noncoding transcript Het
Slc13a1 A T 6: 24,118,083 probably null Het
Slc17a8 T A 10: 89,591,214 T342S probably damaging Het
Slc30a9 A G 5: 67,352,662 E519G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc39a5 G A 10: 128,397,741 L296F probably damaging Het
Slco6b1 A C 1: 96,929,885 noncoding transcript Het
Slco6d1 G A 1: 98,490,616 G509D probably damaging Het
Spen A G 4: 141,471,821 V3142A probably damaging Het
Spta1 T A 1: 174,222,684 H1763Q probably damaging Het
Srcap T C 7: 127,559,952 probably benign Het
Stard9 T C 2: 120,712,847 probably benign Het
Stat4 A G 1: 52,071,947 probably benign Het
Svbp T A 4: 119,196,028 probably benign Het
Tm2d1 A T 4: 98,370,596 probably benign Het
Trpv1 C A 11: 73,240,126 probably null Het
Trrap A G 5: 144,857,422 D3713G possibly damaging Het
Ubr1 T A 2: 120,955,644 D165V probably benign Het
Utrn C A 10: 12,649,153 M2195I probably benign Het
Vmn1r229 G A 17: 20,814,642 V50I possibly damaging Het
Vmn1r44 A T 6: 89,893,650 H126L probably benign Het
Vmn2r116 T C 17: 23,386,596 probably benign Het
Vmn2r27 A C 6: 124,191,632 Y846* probably null Het
Vmn2r84 T A 10: 130,391,990 S126C possibly damaging Het
Xylb T A 9: 119,368,067 probably benign Het
Zfp282 A T 6: 47,890,174 K232* probably null Het
Zfp39 C A 11: 58,890,323 V538L probably benign Het
Zfp560 T C 9: 20,351,853 N76D possibly damaging Het
Zmym4 C T 4: 126,911,169 V433I probably benign Het
Zscan5b A G 7: 6,230,426 E83G probably damaging Het
Other mutations in Bbs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Bbs7 APN 3 36575287 makesense probably null
IGL01533:Bbs7 APN 3 36610235 missense possibly damaging 0.66
IGL01559:Bbs7 APN 3 36594510 missense probably damaging 1.00
IGL01793:Bbs7 APN 3 36605682 critical splice donor site probably null
IGL01867:Bbs7 APN 3 36573547 missense probably benign 0.21
IGL01955:Bbs7 APN 3 36610322 missense probably benign 0.16
IGL02207:Bbs7 APN 3 36604490 missense probably benign 0.10
IGL02212:Bbs7 APN 3 36594409 missense probably benign
IGL02451:Bbs7 APN 3 36610592 missense possibly damaging 0.94
IGL03267:Bbs7 APN 3 36573505 missense probably damaging 1.00
R0010:Bbs7 UTSW 3 36607717 splice site probably null
R0243:Bbs7 UTSW 3 36605734 missense probably benign
R0326:Bbs7 UTSW 3 36592376 missense possibly damaging 0.46
R0372:Bbs7 UTSW 3 36602832 missense probably benign 0.00
R0398:Bbs7 UTSW 3 36590717 missense probably benign
R0453:Bbs7 UTSW 3 36607669 missense possibly damaging 0.79
R0485:Bbs7 UTSW 3 36602873 missense probably damaging 1.00
R0592:Bbs7 UTSW 3 36610297 missense probably benign 0.05
R0619:Bbs7 UTSW 3 36607576 missense probably benign 0.02
R0720:Bbs7 UTSW 3 36592423 missense probably damaging 1.00
R0963:Bbs7 UTSW 3 36613263 missense probably benign 0.22
R1177:Bbs7 UTSW 3 36610180 unclassified probably null
R1242:Bbs7 UTSW 3 36578427 missense probably damaging 1.00
R1336:Bbs7 UTSW 3 36604444 missense probably benign
R1564:Bbs7 UTSW 3 36575795 missense probably damaging 0.99
R2417:Bbs7 UTSW 3 36592397 missense probably damaging 1.00
R3736:Bbs7 UTSW 3 36607670 missense possibly damaging 0.87
R4282:Bbs7 UTSW 3 36573571 missense probably damaging 1.00
R5412:Bbs7 UTSW 3 36599373 missense probably benign
R5444:Bbs7 UTSW 3 36612050 missense possibly damaging 0.50
R5932:Bbs7 UTSW 3 36582698 missense probably benign 0.01
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6030:Bbs7 UTSW 3 36602911 missense probably damaging 0.98
R6148:Bbs7 UTSW 3 36613266 missense probably damaging 1.00
R6173:Bbs7 UTSW 3 36592374 nonsense probably null
R6897:Bbs7 UTSW 3 36598311 missense probably benign 0.07
R6912:Bbs7 UTSW 3 36605704 missense probably benign 0.00
R7224:Bbs7 UTSW 3 36605728 missense possibly damaging 0.48
R7268:Bbs7 UTSW 3 36604426 missense probably benign
X0003:Bbs7 UTSW 3 36575845 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGGCCGTCACTCTTCTGATTACA -3'
(R):5'- GTTCTTCCTGATGCAGCAGCAGT -3'

Sequencing Primer
(F):5'- CTGATTACATGTGGGACGTCCAT -3'
(R):5'- TGATGCAGCAGCAGTCAGTC -3'
Posted On2014-03-14