Incidental Mutation 'R1401:Barx2'
ID160138
Institutional Source Beutler Lab
Gene Symbol Barx2
Ensembl Gene ENSMUSG00000032033
Gene NameBarH-like homeobox 2
Synonyms2310006E12Rik, Barx2b
MMRRC Submission 039463-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R1401 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location31846044-31913462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31859031 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 67 (L67P)
Ref Sequence ENSEMBL: ENSMUSP00000112314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116615]
Predicted Effect probably damaging
Transcript: ENSMUST00000116615
AA Change: L67P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112314
Gene: ENSMUSG00000032033
AA Change: L67P

DomainStartEndE-ValueType
low complexity region 103 113 N/A INTRINSIC
HOX 137 199 3.2e-25 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 268 283 N/A INTRINSIC
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeobox transcription factor family. A highly related protein in mouse has been shown to influence cellular processes that control cell adhesion and remodeling of the actin cytoskeleton in myoblast fusion and chondrogenesis. The encoded protein may also play a role in cancer progression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted gene deletion exhibit short whiskers at birth, defective juvenile hair follicle remodeling, and short adult hair. Fifty percent of homozygotes are born with open eyelids. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abcg1 T A 17: 31,114,158 I625N possibly damaging Het
Adam33 C A 2: 131,051,471 probably benign Het
Adgrl2 A T 3: 148,822,981 I1185N probably damaging Het
Afp A T 5: 90,501,627 probably benign Het
Aggf1 A G 13: 95,364,848 V342A probably benign Het
Ankrd11 A T 8: 122,893,050 S1333R probably benign Het
Arhgef11 C A 3: 87,733,469 S1311* probably null Het
Atp6v1g1 T C 4: 63,548,641 Y47H probably benign Het
Atp8b4 T C 2: 126,323,093 probably null Het
Bbs7 G A 3: 36,573,557 P694S probably benign Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
C2 T C 17: 34,872,481 T69A possibly damaging Het
C8b T G 4: 104,784,482 L205R possibly damaging Het
Cct4 T G 11: 22,994,333 N72K probably damaging Het
Cd300lg C A 11: 102,054,155 P353H possibly damaging Het
Cdh20 A T 1: 104,947,497 I335L possibly damaging Het
Cfhr2 T A 1: 139,811,019 H268L probably benign Het
Chia1 T A 3: 106,128,939 D278E probably benign Het
Cntn6 A G 6: 104,804,398 T482A possibly damaging Het
Cst13 T A 2: 148,823,096 F4I probably benign Het
Ctsc T A 7: 88,281,498 V95E probably damaging Het
Ddhd1 A T 14: 45,605,051 probably null Het
Dmxl2 A T 9: 54,415,428 probably null Het
Dnah5 A C 15: 28,401,913 T3407P probably damaging Het
Dock1 T A 7: 135,133,936 Y1344* probably null Het
Eif4g3 T C 4: 138,206,084 V1740A probably damaging Het
Epb41l5 A G 1: 119,578,904 probably benign Het
Fam159b A T 13: 104,863,605 C37S probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Gm12790 A G 4: 101,968,199 L6P probably benign Het
Gramd4 A G 15: 86,125,196 D210G probably damaging Het
Hectd3 T C 4: 117,002,269 S697P possibly damaging Het
Hsf4 T C 8: 105,275,603 V399A probably benign Het
Hyal6 T A 6: 24,743,435 C377S probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Mypn A G 10: 63,152,857 V463A probably damaging Het
Nav1 T A 1: 135,460,425 I1144L probably benign Het
Nckap5 A G 1: 126,014,661 probably benign Het
Nipbl A T 15: 8,372,173 S30T probably damaging Het
Nmt1 T C 11: 103,057,481 F277S probably damaging Het
Nploc4 A C 11: 120,383,289 probably benign Het
Nup54 C A 5: 92,428,221 R137I probably damaging Het
Olfr667 T C 7: 104,916,756 Y180C probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pkd1l1 G T 11: 8,854,487 Y1701* probably null Het
Plekhg6 T C 6: 125,363,109 T763A probably damaging Het
Pmepa1 C T 2: 173,228,575 probably null Het
Ppfia2 A G 10: 106,830,657 E408G possibly damaging Het
Pramef12 G A 4: 144,395,088 T122M probably benign Het
Prl8a2 G A 13: 27,353,996 V218I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
RP23-114B10.6 T C 8: 69,373,370 noncoding transcript Het
Slc13a1 A T 6: 24,118,083 probably null Het
Slc17a8 T A 10: 89,591,214 T342S probably damaging Het
Slc30a9 A G 5: 67,352,662 E519G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc39a5 G A 10: 128,397,741 L296F probably damaging Het
Slco6b1 A C 1: 96,929,885 noncoding transcript Het
Slco6d1 G A 1: 98,490,616 G509D probably damaging Het
Spen A G 4: 141,471,821 V3142A probably damaging Het
Spta1 T A 1: 174,222,684 H1763Q probably damaging Het
Srcap T C 7: 127,559,952 probably benign Het
Stard9 T C 2: 120,712,847 probably benign Het
Stat4 A G 1: 52,071,947 probably benign Het
Svbp T A 4: 119,196,028 probably benign Het
Tm2d1 A T 4: 98,370,596 probably benign Het
Trpv1 C A 11: 73,240,126 probably null Het
Trrap A G 5: 144,857,422 D3713G possibly damaging Het
Ubr1 T A 2: 120,955,644 D165V probably benign Het
Utrn C A 10: 12,649,153 M2195I probably benign Het
Vmn1r229 G A 17: 20,814,642 V50I possibly damaging Het
Vmn1r44 A T 6: 89,893,650 H126L probably benign Het
Vmn2r116 T C 17: 23,386,596 probably benign Het
Vmn2r27 A C 6: 124,191,632 Y846* probably null Het
Vmn2r84 T A 10: 130,391,990 S126C possibly damaging Het
Xylb T A 9: 119,368,067 probably benign Het
Zfp282 A T 6: 47,890,174 K232* probably null Het
Zfp39 C A 11: 58,890,323 V538L probably benign Het
Zfp560 T C 9: 20,351,853 N76D possibly damaging Het
Zmym4 C T 4: 126,911,169 V433I probably benign Het
Zscan5b A G 7: 6,230,426 E83G probably damaging Het
Other mutations in Barx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Barx2 APN 9 31846845 missense unknown
IGL02045:Barx2 APN 9 31858798 missense probably damaging 1.00
IGL03341:Barx2 APN 9 31858794 missense probably damaging 1.00
R1982:Barx2 UTSW 9 31913012 missense probably damaging 1.00
R2436:Barx2 UTSW 9 31913087 missense probably damaging 0.99
R4543:Barx2 UTSW 9 31846796 missense unknown
R4804:Barx2 UTSW 9 31846812 missense unknown
R5399:Barx2 UTSW 9 31854111 critical splice donor site probably null
R5436:Barx2 UTSW 9 31912989 missense probably damaging 1.00
R5700:Barx2 UTSW 9 31858765 missense probably damaging 1.00
R6036:Barx2 UTSW 9 31913008 missense probably damaging 1.00
R6036:Barx2 UTSW 9 31913008 missense probably damaging 1.00
R6042:Barx2 UTSW 9 31846903 missense probably benign 0.35
R6533:Barx2 UTSW 9 31912979 missense probably damaging 1.00
R6618:Barx2 UTSW 9 31846872 missense probably benign 0.01
Z1088:Barx2 UTSW 9 31846866 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TGAAGATGGTGCGACTTCTGCG -3'
(R):5'- GGTACAAATGGCCTCATGCCCAAG -3'

Sequencing Primer
(F):5'- GGCTGTTCTGTCTCTGACTCG -3'
(R):5'- AGGCTTAGTGTAGCCAGCTC -3'
Posted On2014-03-14