Incidental Mutation 'R1401:Cct4'
ID160150
Institutional Source Beutler Lab
Gene Symbol Cct4
Ensembl Gene ENSMUSG00000007739
Gene Namechaperonin containing Tcp1, subunit 4 (delta)
Synonyms2610204B21Rik, A45, T complex protein 1, delta, Cctd, TCP-1 delta
MMRRC Submission 039463-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1401 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location22990519-23003780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 22994333 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 72 (N72K)
Ref Sequence ENSEMBL: ENSMUSP00000134248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020562] [ENSMUST00000173853] [ENSMUST00000173867] [ENSMUST00000174047] [ENSMUST00000174659]
Predicted Effect probably benign
Transcript: ENSMUST00000020562
SMART Domains Protein: ENSMUSP00000020562
Gene: ENSMUSG00000007739

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 61 509 1.6e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173853
SMART Domains Protein: ENSMUSP00000133677
Gene: ENSMUSG00000007739

DomainStartEndE-ValueType
PDB:4B2T|D 1 44 2e-11 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000173867
AA Change: N72K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133523
Gene: ENSMUSG00000007739
AA Change: N72K

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 539 1.9e-159 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174047
AA Change: N72K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134248
Gene: ENSMUSG00000007739
AA Change: N72K

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 44 93 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174244
Predicted Effect probably benign
Transcript: ENSMUST00000174659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174746
Meta Mutation Damage Score 0.464 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The chaperonin containing TCP1 (MIM 186980) complex (CCT), also called the TCP1 ring complex, consists of 2 back-to-back rings, each containing 8 unique but homologous subunits, such as CCT4. CCT assists the folding of newly translated polypeptide substrates through multiple rounds of ATP-driven release and rebinding of partially folded intermediate forms. Substrates of CCT include the cytoskeletal proteins actin (see MIM 102560) and tubulin (see MIM 191130), as well as alpha-transducin (MIM 139330) (Won et al., 1998 [PubMed 9819444]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abcg1 T A 17: 31,114,158 I625N possibly damaging Het
Adam33 C A 2: 131,051,471 probably benign Het
Adgrl2 A T 3: 148,822,981 I1185N probably damaging Het
Afp A T 5: 90,501,627 probably benign Het
Aggf1 A G 13: 95,364,848 V342A probably benign Het
Ankrd11 A T 8: 122,893,050 S1333R probably benign Het
Arhgef11 C A 3: 87,733,469 S1311* probably null Het
Atp6v1g1 T C 4: 63,548,641 Y47H probably benign Het
Atp8b4 T C 2: 126,323,093 probably null Het
Barx2 A G 9: 31,859,031 L67P probably damaging Het
Bbs7 G A 3: 36,573,557 P694S probably benign Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
C2 T C 17: 34,872,481 T69A possibly damaging Het
C8b T G 4: 104,784,482 L205R possibly damaging Het
Cd300lg C A 11: 102,054,155 P353H possibly damaging Het
Cdh20 A T 1: 104,947,497 I335L possibly damaging Het
Cfhr2 T A 1: 139,811,019 H268L probably benign Het
Chia1 T A 3: 106,128,939 D278E probably benign Het
Cntn6 A G 6: 104,804,398 T482A possibly damaging Het
Cst13 T A 2: 148,823,096 F4I probably benign Het
Ctsc T A 7: 88,281,498 V95E probably damaging Het
Ddhd1 A T 14: 45,605,051 probably null Het
Dmxl2 A T 9: 54,415,428 probably null Het
Dnah5 A C 15: 28,401,913 T3407P probably damaging Het
Dock1 T A 7: 135,133,936 Y1344* probably null Het
Eif4g3 T C 4: 138,206,084 V1740A probably damaging Het
Epb41l5 A G 1: 119,578,904 probably benign Het
Fam159b A T 13: 104,863,605 C37S probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Gm12790 A G 4: 101,968,199 L6P probably benign Het
Gramd4 A G 15: 86,125,196 D210G probably damaging Het
Hectd3 T C 4: 117,002,269 S697P possibly damaging Het
Hsf4 T C 8: 105,275,603 V399A probably benign Het
Hyal6 T A 6: 24,743,435 C377S probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Mypn A G 10: 63,152,857 V463A probably damaging Het
Nav1 T A 1: 135,460,425 I1144L probably benign Het
Nckap5 A G 1: 126,014,661 probably benign Het
Nipbl A T 15: 8,372,173 S30T probably damaging Het
Nmt1 T C 11: 103,057,481 F277S probably damaging Het
Nploc4 A C 11: 120,383,289 probably benign Het
Nup54 C A 5: 92,428,221 R137I probably damaging Het
Olfr667 T C 7: 104,916,756 Y180C probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pkd1l1 G T 11: 8,854,487 Y1701* probably null Het
Plekhg6 T C 6: 125,363,109 T763A probably damaging Het
Pmepa1 C T 2: 173,228,575 probably null Het
Ppfia2 A G 10: 106,830,657 E408G possibly damaging Het
Pramef12 G A 4: 144,395,088 T122M probably benign Het
Prl8a2 G A 13: 27,353,996 V218I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
RP23-114B10.6 T C 8: 69,373,370 noncoding transcript Het
Slc13a1 A T 6: 24,118,083 probably null Het
Slc17a8 T A 10: 89,591,214 T342S probably damaging Het
Slc30a9 A G 5: 67,352,662 E519G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc39a5 G A 10: 128,397,741 L296F probably damaging Het
Slco6b1 A C 1: 96,929,885 noncoding transcript Het
Slco6d1 G A 1: 98,490,616 G509D probably damaging Het
Spen A G 4: 141,471,821 V3142A probably damaging Het
Spta1 T A 1: 174,222,684 H1763Q probably damaging Het
Srcap T C 7: 127,559,952 probably benign Het
Stard9 T C 2: 120,712,847 probably benign Het
Stat4 A G 1: 52,071,947 probably benign Het
Svbp T A 4: 119,196,028 probably benign Het
Tm2d1 A T 4: 98,370,596 probably benign Het
Trpv1 C A 11: 73,240,126 probably null Het
Trrap A G 5: 144,857,422 D3713G possibly damaging Het
Ubr1 T A 2: 120,955,644 D165V probably benign Het
Utrn C A 10: 12,649,153 M2195I probably benign Het
Vmn1r229 G A 17: 20,814,642 V50I possibly damaging Het
Vmn1r44 A T 6: 89,893,650 H126L probably benign Het
Vmn2r116 T C 17: 23,386,596 probably benign Het
Vmn2r27 A C 6: 124,191,632 Y846* probably null Het
Vmn2r84 T A 10: 130,391,990 S126C possibly damaging Het
Xylb T A 9: 119,368,067 probably benign Het
Zfp282 A T 6: 47,890,174 K232* probably null Het
Zfp39 C A 11: 58,890,323 V538L probably benign Het
Zfp560 T C 9: 20,351,853 N76D possibly damaging Het
Zmym4 C T 4: 126,911,169 V433I probably benign Het
Zscan5b A G 7: 6,230,426 E83G probably damaging Het
Other mutations in Cct4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Cct4 APN 11 22997656 missense possibly damaging 0.63
IGL02076:Cct4 APN 11 23002394 missense probably damaging 1.00
IGL02211:Cct4 APN 11 22993327 intron probably benign
IGL02416:Cct4 APN 11 23002868 missense probably damaging 1.00
R0030:Cct4 UTSW 11 23001357 unclassified probably benign
R0255:Cct4 UTSW 11 22999073 missense probably damaging 1.00
R0494:Cct4 UTSW 11 22996014 missense probably benign
R1244:Cct4 UTSW 11 22996417 missense probably benign 0.02
R1276:Cct4 UTSW 11 23002171 missense probably damaging 1.00
R1465:Cct4 UTSW 11 23002922 missense probably damaging 1.00
R1465:Cct4 UTSW 11 23002922 missense probably damaging 1.00
R1809:Cct4 UTSW 11 22997615 missense probably benign 0.00
R3907:Cct4 UTSW 11 23001560 missense probably benign 0.00
R4640:Cct4 UTSW 11 23002297 missense probably benign 0.04
R4785:Cct4 UTSW 11 23002866 missense probably damaging 1.00
R4836:Cct4 UTSW 11 23002898 missense probably benign 0.20
R5846:Cct4 UTSW 11 23001354 unclassified probably benign
R7193:Cct4 UTSW 11 22997111 missense probably benign 0.00
R7214:Cct4 UTSW 11 22990616 unclassified probably benign
R7336:Cct4 UTSW 11 23001564 missense possibly damaging 0.85
X0019:Cct4 UTSW 11 22997118 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTGCCGCCATTACTAGATGCAGAG -3'
(R):5'- GCTGGATTGCTGCCAAGTTCAAG -3'

Sequencing Primer
(F):5'- CAGAGCCCGTTGATCTGAATG -3'
(R):5'- TGCTGCCAAGTTCAAGGATCTAC -3'
Posted On2014-03-14