Incidental Mutation 'R1401:Flt4'
ID160151
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 039463-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1401 (G1)
Quality Score107
Status Validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 49636339 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect probably benign
Transcript: ENSMUST00000020617
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.4%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Abcg1 T A 17: 31,114,158 I625N possibly damaging Het
Adam33 C A 2: 131,051,471 probably benign Het
Adgrl2 A T 3: 148,822,981 I1185N probably damaging Het
Afp A T 5: 90,501,627 probably benign Het
Aggf1 A G 13: 95,364,848 V342A probably benign Het
Ankrd11 A T 8: 122,893,050 S1333R probably benign Het
Arhgef11 C A 3: 87,733,469 S1311* probably null Het
Atp6v1g1 T C 4: 63,548,641 Y47H probably benign Het
Atp8b4 T C 2: 126,323,093 probably null Het
Barx2 A G 9: 31,859,031 L67P probably damaging Het
Bbs7 G A 3: 36,573,557 P694S probably benign Het
Btbd10 A T 7: 113,347,059 V33E probably benign Het
C2 T C 17: 34,872,481 T69A possibly damaging Het
C8b T G 4: 104,784,482 L205R possibly damaging Het
Cct4 T G 11: 22,994,333 N72K probably damaging Het
Cd300lg C A 11: 102,054,155 P353H possibly damaging Het
Cdh20 A T 1: 104,947,497 I335L possibly damaging Het
Cfhr2 T A 1: 139,811,019 H268L probably benign Het
Chia1 T A 3: 106,128,939 D278E probably benign Het
Cntn6 A G 6: 104,804,398 T482A possibly damaging Het
Cst13 T A 2: 148,823,096 F4I probably benign Het
Ctsc T A 7: 88,281,498 V95E probably damaging Het
Ddhd1 A T 14: 45,605,051 probably null Het
Dmxl2 A T 9: 54,415,428 probably null Het
Dnah5 A C 15: 28,401,913 T3407P probably damaging Het
Dock1 T A 7: 135,133,936 Y1344* probably null Het
Eif4g3 T C 4: 138,206,084 V1740A probably damaging Het
Epb41l5 A G 1: 119,578,904 probably benign Het
Fam159b A T 13: 104,863,605 C37S probably damaging Het
Fnbp1l C T 3: 122,546,306 R499Q probably damaging Het
Gm12790 A G 4: 101,968,199 L6P probably benign Het
Gramd4 A G 15: 86,125,196 D210G probably damaging Het
Hectd3 T C 4: 117,002,269 S697P possibly damaging Het
Hsf4 T C 8: 105,275,603 V399A probably benign Het
Hyal6 T A 6: 24,743,435 C377S probably damaging Het
Myb C T 10: 21,152,945 V85M probably damaging Het
Mypn A G 10: 63,152,857 V463A probably damaging Het
Nav1 T A 1: 135,460,425 I1144L probably benign Het
Nckap5 A G 1: 126,014,661 probably benign Het
Nipbl A T 15: 8,372,173 S30T probably damaging Het
Nmt1 T C 11: 103,057,481 F277S probably damaging Het
Nploc4 A C 11: 120,383,289 probably benign Het
Nup54 C A 5: 92,428,221 R137I probably damaging Het
Olfr667 T C 7: 104,916,756 Y180C probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pkd1l1 G T 11: 8,854,487 Y1701* probably null Het
Plekhg6 T C 6: 125,363,109 T763A probably damaging Het
Pmepa1 C T 2: 173,228,575 probably null Het
Ppfia2 A G 10: 106,830,657 E408G possibly damaging Het
Pramef12 G A 4: 144,395,088 T122M probably benign Het
Prl8a2 G A 13: 27,353,996 V218I possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
RP23-114B10.6 T C 8: 69,373,370 noncoding transcript Het
Slc13a1 A T 6: 24,118,083 probably null Het
Slc17a8 T A 10: 89,591,214 T342S probably damaging Het
Slc30a9 A G 5: 67,352,662 E519G probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slc39a5 G A 10: 128,397,741 L296F probably damaging Het
Slco6b1 A C 1: 96,929,885 noncoding transcript Het
Slco6d1 G A 1: 98,490,616 G509D probably damaging Het
Spen A G 4: 141,471,821 V3142A probably damaging Het
Spta1 T A 1: 174,222,684 H1763Q probably damaging Het
Srcap T C 7: 127,559,952 probably benign Het
Stard9 T C 2: 120,712,847 probably benign Het
Stat4 A G 1: 52,071,947 probably benign Het
Svbp T A 4: 119,196,028 probably benign Het
Tm2d1 A T 4: 98,370,596 probably benign Het
Trpv1 C A 11: 73,240,126 probably null Het
Trrap A G 5: 144,857,422 D3713G possibly damaging Het
Ubr1 T A 2: 120,955,644 D165V probably benign Het
Utrn C A 10: 12,649,153 M2195I probably benign Het
Vmn1r229 G A 17: 20,814,642 V50I possibly damaging Het
Vmn1r44 A T 6: 89,893,650 H126L probably benign Het
Vmn2r116 T C 17: 23,386,596 probably benign Het
Vmn2r27 A C 6: 124,191,632 Y846* probably null Het
Vmn2r84 T A 10: 130,391,990 S126C possibly damaging Het
Xylb T A 9: 119,368,067 probably benign Het
Zfp282 A T 6: 47,890,174 K232* probably null Het
Zfp39 C A 11: 58,890,323 V538L probably benign Het
Zfp560 T C 9: 20,351,853 N76D possibly damaging Het
Zmym4 C T 4: 126,911,169 V433I probably benign Het
Zscan5b A G 7: 6,230,426 E83G probably damaging Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ACCCAGAACTTGTGCCACAGGATG -3'
(R):5'- ATGTGCTGCTAACCCTACAGAGCC -3'

Sequencing Primer
(F):5'- AAGCTCTTTGGGACAGGTCAC -3'
(R):5'- TAACCCTACAGAGCCAGAGG -3'
Posted On2014-03-14